Alert icon

Scheduled maintenance: Wednesday, May 21, 8:00 p.m. to Thursday, May 22, 4:00 a.m. Eastern. Browse atcc.org may have interruptions. We apologize for any inconvenience.

Contact us
ATCC 100 Years Logo Anniversary ATCC 100 Years Logo Anniversary Cart 0
  • Quick Order
  • Careers
  • Support

HCT116-SLC25A23-KO-c2

CRL-3488

The HCT116-SLC25A23-KO-c2 cell line contains a -2 bp deletion in SLC25A23 gene and combined with the parental cell line and other HCT116 derivatives can be used in cancer drug screening.

This cell line was generated by the RESOLUTE project.

Product category
Human cells
Product type
Cell model
Organism
Homo sapiens, human
Morphology

Epithelial-like

Tissue
Large intestine; Colon
Disease
Carcinoma; Colorectal
Applications
Cancer research
Drug development
Product format
Frozen
Storage conditions
Vapor phase of liquid nitrogen
Buy Now
Price: $844.00 ea
Discounts may be available for our fellow nonprofit organizations. Login to see your price.

Generally ships within 1-3 business days

Documentation

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

Cells contain Lentivirus genes

Cells contain cytomegalovirus (CMV)

Cells contain SV40 sequences

ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.

Required Products

These products are vital for the proper use of this item and have been confirmed as effective in supporting functionality. If you use alternative products, the quality and effectiveness of the item may be affected.

Detailed product information

General

Specific applications

Cancer drug screening, oncology therapeutic development

Characteristics

Cells per vial
Approximately 2.0 to 3.0 x 106
Volume
1.0 mL
Growth properties
Adherent
Age
adult
Gender
Male
Comments

Solute transporter carrier (SLC) knock out cell line.

HCT 116 cells were stably transduced with a pLentiCRISPRv2 vector expressing a gene-specific gRNA against SLC25A23 (ACGTGCACGAGTTGCGCCAG) and a puromycin resistance marker. Single cell clones were sorted, expanded and genotyped to identify KO clones.

-2 deletion in SLC25A23 gene

Note: Cells contain S. pyogenes, lentivirus,CMV (Cytomegalovirus), and SV40 sequences

Handling information

Complete medium

The base medium for this cell line is RPMI 1640 (Corning cat # 10-040-CV). To make the complete medium add 10% Fetal Bovine Serum (FBS; ATCC 30-2020).

Temperature
37°C
Atmosphere
95% Air, 5% CO2
Handling procedure

To ensure the highest level of viability, thaw the vial and initiate the culture as soon as possible upon receipt. If upon arrival, continued storage of the frozen culture is necessary, it should be stored in liquid nitrogen vapor phase and not at -70° C. Storage at -70°C will result in loss of viability. 

  1. Thaw the vial by gentle agitation in a 37°C water bath. To reduce the possibility of contamination, keep the O-ring and cap out of the water. Thawing should be rapid (approximately 2 minutes).
  2. Remove the vial from the water bath as soon as the contents are thawed and decontaminate by dipping in or spraying with 70% ethanol. All of the operations from this point on should be carried out under strict aseptic conditions.
  3. Transfer the vial contents to a centrifuge tube containing 9.0 mL complete culture medium. and spin at approximately 150 to 400 x g for 8 to 12 minutes.
  4. Resuspend cell pellet with the recommended complete medium (see the specific batch information for the culture recommended dilution ratio). It is important to avoid excessive alkalinity of the medium during recovery of the cells. It is suggested that, prior to the addition of the vial contents, the culture vessel containing the complete growth medium be placed into the incubator for at least 15 minutes to allow the medium to reach its normal pH (7.0 to 7.6). pH (7.0 to 7.6).
  5. Incubate the culture at 37° C in a suitable incubator. A 5% CO2 in air atmosphere is recommended if using the medium described on this product sheet.

     

Subculturing procedure

Volumes used in this protocol are for 75 cm2 flask; proportionally reduce or increase amount of dissociation medium for culture vessels of other sizes. Corning® T-75 flasks (catalog #430641) are recommended for subculturing this product.

  1. Remove and discard culture medium.
  2. Briefly rinse the cell layer with 0.25% (w/v) Trypsin- 0.53 mM EDTA solution to remove all traces of serum that contains trypsin inhibitor.
  3. Add 2.0 to 3.0 mL of Trypsin-EDTA solution to flask and observe cells under an inverted microscope until cell layer is dispersed (usually within 5 to 15 minutes).
  4. Note: To avoid clumping do not agitate the cells by hitting or shaking the flask while waiting for the cells to detach. Cells that are difficult to detach may be placed at 37°C to facilitate dispersal.
  5. Add 6.0 to 8.0 mL of complete growth medium and aspirate cells by gently pipetting.
  6. Add appropriate aliquots of the cell suspension to new culture vessels.
  7. Cultures can be established between 2.0 x 104 and 4.0 x 104 viable cells/cm2.
  8. Incubate cultures at 37°C.

Interval: Maintain cultures at a cell concentration between 1.0 X 104 and 4.0 X 104 cell/cm2.

Subcultivation Ratio: A subcultivation ratio of 1:3 to 1:8 is recommended

Medium Renewal: 2 to 3 times per week

Reagents for cryopreservation

85% RPMI 1640 + 10% FBS + 5% DMSO

Quality control specifications

Bacterial and fungal testing
Not detected
Mycoplasma contamination
Not detected
Virus testing
Cytomegalovirus (CMV): Not detected
Hepatitis B virus (HBV): Not detected
Epstein-Barr virus (EBV): Not detected
Human Immunodeficiency virus (HIV): Not detected
Human papillomavirus (HPV): Not detected
Functional tests

Genotype: PCR amplification of genomic DNA extracted from test sample

followed by NGS to verify unique target gene alterations.

Specification: Sequencing is 100% match to the reference sequence. 

STR profiling
Amelogenin: X
CSF1PO: 7, 10
D13S317: 10, 11
D16S539: 11, 13
D5S818: 10, 11
D7S820: 11, 12
THO1: 8, 9
TPOX: 8
vWA: 17, 22

History

Depositors

Giulio Superti-Furga 

(Principal Investigator)

CeMM Research Center for Molecular Medicine

of the Austrian Academy of Sciences.

Lazarettgasse 14, AKH BT 25.3

1090 Vienna, Austria

Year of origin
2019

Legal disclaimers

Intended use
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.
Warranty

The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Permits & Restrictions

This material is subject to the following restrictions in addition to those outlined in the ATCC Material Transfer Agreement:

  1. CRISPR Label License 

For information on obtaining additional rights, please contact:

ATCC Licensing
Email: [email protected]

This material is subject to the following restrictions in addition to those outlined in the ATCC Material Transfer Agreement:

  1. CRISPR Label License, ERS Genomics 

For information on obtaining additional rights, please contact:

ATCC Licensing
Email: [email protected]

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

Frequently Asked Questions

References

For product-related inquiries and issues, contact Product Experience:

Message Us

Hours of Operation

Monday - Friday
9:00am - 5:00pm
US Eastern Time