HCT116-SLC15A4-KO-c10
CRL-3510 ™
This cell line was generated by the RESOLUTE project.
CRL-3510 ™
This cell line was generated by the RESOLUTE project.
Epithelial-like
ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.
Cells contain Lentivirus genes
Cells contain cytomegalovirus (CMV)
Cells contain SV40 sequences
ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.
Cancer drug screening, oncology therapeutic development
Solute transporter carrier (SLC) knock out cell line.
HCT 116 cells were stably transduced with a pLentiCRISPRv2 vector expressing a gene-specific gRNA against SLC15A4 (CTACGGCATCACGTCCAACC) and a puromycin resistance marker. Single cell clones were sorted, expanded and genotyped to identify KO clones.
-7 deletion in SLC15A4 gene
Note: Cells contain S. pyogenes, lentivirus,CMV (Cytomegalovirus), and SV40 sequencesThe base medium for this cell line is RPMI 1640 (Corning cat # 10-040-CV). To make the complete medium add 10% Fetal Bovine Serum (FBS; ATCC 30-2020).
To ensure the highest level of viability, thaw the vial and initiate the culture as soon as possible upon receipt. If upon arrival, continued storage of the frozen culture is necessary, it should be stored in liquid nitrogen vapor phase and not at -70° C. Storage at -70°C will result in loss of viability.
Volumes used in this protocol are for 75 cm2 flask; proportionally reduce or increase amount of dissociation medium for culture vessels of other sizes. Corning® T-75 flasks (catalog #430641) are recommended for subculturing this product.
Interval: Maintain cultures at a cell concentration between 1.0 X 104 and 4.0 X 104 cell/cm2.
Subcultivation Ratio: A subcultivation ratio of 1:3 to 1:8 is recommended
Medium Renewal: 2 to 3 times per week
85% RPMI 1640 + 10% FBS + 5% DMSO
Genotype: PCR amplification of genomic DNA extracted from test sample
followed by NGS to verify unique target gene alterations.
Specification: Sequencing is 100% match to the reference sequence.
Giulio Superti-Furga
(Principal Investigator)
CeMM Research Center for Molecular Medicine
of the Austrian Academy of Sciences.
Lazarettgasse 14, AKH BT 25.3
1090 Vienna, Austria
The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid. Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.
While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.
This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.
Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.
This material is subject to the following restrictions in addition to those outlined in the ATCC Material Transfer Agreement:
For information on obtaining additional rights, please contact:
ATCC Licensing
Email: [email protected]
This material is subject to the following restrictions in addition to those outlined in the ATCC Material Transfer Agreement:
For information on obtaining additional rights, please contact:
ATCC Licensing
Email: [email protected]
This material is subject to the following restrictions in addition to those outlined in the ATCC Material Transfer Agreement:
For information on obtaining additional rights, please contact:
ATCC Licensing
Email: [email protected]