To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Quantitative Synthetic SARS-CoV [2003] RNA (ATCC® VR-3280SD)

Product Format: frozen
Specification range: 1 x 105 to 1 x 106 copies/µL
100 µL per vial with Biomatrica RNAstable

Permits and Restrictions

View Permits

Agent Quantitative Synthetic SARS-CoV [2003] RNA
Applications ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day-to-day test variation, and lot-to-lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine viral load.
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Specification range: 1 x 105 to 1 x 106 copies/µL
100 µL per vial with Biomatrica RNAstable
Storage Conditions -70°C or colder
Intended Use The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent.

Biomatrica Logo
Comments Manufactured under ISO 13485 guidance

Preparation includes fragments from the nsp9 (RdRp), nsp11 and N regions.

The following primers and probe can be used with this nucleic acid preparation.
Forward primer (5’ to 3’): ACCAGAATGGAGGACGCAATG
Reverse primer (5’ to 3’): GCTGTGAACCAAGACGCAGTATTAT
Probe (5’ to 3’): 6FAM/ACCCCAAGGTTTACCC/MGBNFQ
Name of Depositor ATCC
References

Bellini WJ. SARS-CoV Specific RT-PCR Primers. CDC Official Communication. https://www.who.int/csr/sars/CDCprimers.pdf.  Accessed April 02, 2020.

PCR primers for SARS developed by WHO Network Laboratories.  https://www.who.int/csr/sars/primers/en/.  Published April 17, 2003.  Accessed April 02, 2020.

Booth TF, et al. Detection of airborne severe acute respiratory syndrome (SARS) coronavirus and environmental contamination in SARS outbreak units. J Infect Dis 191(9): 1472-1477, 2005. PubMed: 15809906

Lau LT, et al. A real-time PCR for SARS-coronavirus incorporating target gene pre-amplification. Biochem Biophys Res Commun 312(4): 1290-1296, 2003. PubMed: 14652014

Keyaerts E, et al. Viral load quantitation of SARS-coronavirus RNA using a one-step real-time RT-PCR.  Int J Infect Dis 10(1): 32-37, 2006. PubMed: 16023880

Zhai J, et al. Real-time polymerase chain reaction for detecting SARS coronavirus, Beijing, 2003. Emerg Infect Dis. 10(2): 300-303, 2004. PubMed: 15030701

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • This item is listed on the Commerce Control List of the U.S. Department of Commerce and is distributed only within the 50 United States. Distribution requires completion of a Customer Acceptance of Responsibility (CAR) for Commerce Control List (CCL) Biologicals form.
Basic Documentation