American Type Culture Collection (ATCC) Logo American Type Culture Collection (ATCC) Logo Cart 0
  • Careers
  • Support

Cutaneotrichosporon oleaginosum (Zhou et al.) Liu et al.

20509

Download Genome Learn about the ATCC Genome Portal
An ampoule containing viable cells (may include spores and mycelia) suspended in cryoprotectant.
Product category
Fungi
Product type
Yeast
Classification
Fungi, Dikarya, Basidiomycota, Agaricomycotina, Tremellomycetes, Trichosporonales, Trichosporonaceae, Cutaneotrichosporon
Strain designation
D
Type strain
Yes
Genome sequenced strain
Yes
Isolation source
Dairy plant
Applications
Biofuel production
Food production research
Product format
Frozen
Storage conditions
-80°C or colder
Buy Now
Price: $486.00 EA
Discounts may be available for our fellow nonprofit organizations. Login to see your price.

Generally ships within 1-3 business days

Documentation

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.

Detailed product information

General

Specific applications
Potential biofuel production agent: biodiesel
Degrades beets RefBednarski W, et al. Utilization of beet molasses and whey for fat biosynthesis by a yeast. Agric. Wastes 18: 19-26, 1986.
Degrades molasses RefBednarski W, et al. Utilization of beet molasses and whey for fat biosynthesis by a yeast. Agric. Wastes 18: 19-26, 1986.
Degrades prickly-pear juice RefHassan M, et al. Production of single-cell oil from prickly-pear juice fermentation by Cryptococcus curvatus grown in batch culture. World J. Microbiol. Biotechnol. 10: 534-537, 1994.
Degrades whey (Moon NJ, Hammond EG. Process for converting whey permeate to oil-containing yeast. US Patent 4,235,933 dated Nov 25 1980) RefFloetenmeyer MD, et al. Continuous culture fermentation of whey permeate to produce microbial oil. J. Dairy Sci. 68: 633-637, 1985.  RefBednarski W, et al. Utilization of beet molasses and whey for fat biosynthesis by a yeast. Agric. Wastes 18: 19-26, 1986.
Produces alpha-galactosidase RefWest M, et al. Purification and properties of two lactose hydrolases from Trichosporon cutaneum. J. Gen. Microbiol. 136: 1483-1490, 1990. PubMed: 2124610
Produces glucosidase, beta, acid, glucocerebrosidase
Produces lipids RefBrown BD, et al. A relationship between growth and lipid accumulation in Candida curvata D. J. Ferment. Bioeng. 68: 344-352, 1989.  RefYkema A, et al. Growth yield, maintenance requirements, and lipid formation in the oleaginous yeast Apiotrichum curvatum. Biotechnol. Bioeng. 34: 1268-1276, 1989.  RefYkema A, et al. Optimization of lipid production in the oleaginous yeast Apiotrichum curvatum in whey permeate. Appl. Microbiol. Biotechnol. 29: 211-218, 1988.  RefVerwoert II, et al. Modification of the fatty-acid composition in lipids of the oleaginous yeast Apiotrichum curvatum by intraspecific spheroplast fusion. Appl. Microbiol. Biotechnol. 32: 327-333, 1989.  (Moon NJ, Hammond EG. Process for converting whey permeate to oil-containing yeast. US Patent 4,235,933 dated Nov 25 1980) RefWang LW, et al. Spectrophotometric determination of polar and non-polar lipids in oleaginous yeast. World J. Microbiol. Biotechnol. 9: 350-352, 1993.  RefHassan M, et al. Production of single-cell oil from prickly-pear juice fermentation by Cryptococcus curvatus grown in batch culture. World J. Microbiol. Biotechnol. 10: 534-537, 1994.  RefFloetenmeyer MD, et al. Continuous culture fermentation of whey permeate to produce microbial oil. J. Dairy Sci. 68: 633-637, 1985.  RefBednarski W, et al. Utilization of beet molasses and whey for fat biosynthesis by a yeast. Agric. Wastes 18: 19-26, 1986.
Produces single-cell protein SCP RefHassan M, et al. Production of single-cell oil from prickly-pear juice fermentation by Cryptococcus curvatus grown in batch culture. World J. Microbiol. Biotechnol. 10: 534-537, 1994.

Potential strain for oil or fat production

Potential strain for single cell protein production for food or feed

Preceptrol
No

Characteristics

Comments
Influence of nitrogen- and iron-limitation on lipid production RefHassan M, et al. Influence of nitrogen and iron limitations on lipid production by Cryptococcus curvatus grown in batch and fed-batch culture. Process Biochem. 31: 355-361, 1996.
This strain was re-identified as Trichosporon oleaginosus based on the DNA barcode sequence comparison.
Peroxisomes RefPark WS, et al. Evidence of peroxisomes and peroxisomal enzyme activities in the oleaginous yeast Apiotrichum curvatum. Can. J. Microbiol. 37: 361-367, 1991. PubMed: 1878814
Genome sequencing strain (Joint Genome Institute, Department of Energy, USA )
Technical information
ATCC Product Experience does not have technical information on patent deposits that are not produced or characterized by ATCC. Additional information can be found in the corresponding patent available from the patent holder or with the U.S. and/or international patent office.

Handling information

Medium
Temperature
24-26°C
Atmosphere
Aerobic
Handling procedure
Frozen ampoules packed in dry ice should either be thawed immediately or stored in liquid nitrogen.  If liquid nitrogen storage facilities are not available, frozen ampoules may be stored at or below -70°C for approximately one week.  Do not under any circumstance store frozen ampoules at refrigerator freezer temperatures (generally -20°C).  Storage of frozen material at this temperature will result in the death of the culture.

  1. To thaw a frozen ampoule, place in a 25°C to 30°C water bath, until just thawed (approximately 5 minutes).  Immerse the ampoule just sufficient to cover the frozen material.  Do not agitate the ampoule.
  2. Immediately after thawing, wipe down ampoule with 70% ethanol and aseptically transfer 50 µL (or any amount desired up to all) of the content onto a plate or broth with medium recommended.
  3. Incubate the inoculum/strain at the temperature and conditions recommended. Inspect for growth of the inoculum/strain regularly. The sign of viability is noticeable typically after 1-2 days of incubation. However, the time necessary for significant growth will vary from strain to strain.
Handling notes
Deposited as Candida curvata; produces single-cell protein (SCP); degrades whey.
Additional, updated information on this product may be available on the ATCC® web site at www.atcc.org.

Quality control specifications

Sequenced data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence (including the D1D2 region)

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTGCTCTTTGAGCGTTAACTACATCCATCTACATCTGTGAACTGTTGATTGACTTCGGTCAATAACTTTTACAAACACTGTGTAATGAACGTCATGTTATTATAACAAAAATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTATCATGAAATCTCAACCATTAGGGTTTCTTAATGGCTTGGAATTGGGCGCTGCCACTTGCCTGGCTCGCCTTAAAAGAGTTAGCGTGTTAAACTTGTCGTAAACTGGCGTAATAAGTTTCGCTGGTGGTAGACTTGTGAAGGACGCTTCTAATCGTCTTCGGACACTTCTTGAACTCTGGTCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAAAGCTCAAATTTGTAATCTGGCTGTCTTCGATAGTCCGAGTTGTAATCTATAGACGTGTTTTCCGTGCTGGACCGTATCTAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGACAATCCCGTGCTTGATACGACCACCAGTGCTCTGTGATACACGTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTCTTCAGATTCAGCTGGTTCTTCCAGTCTACTTCTGTGGAACGGGTCAACATCAGTTTTGTCCGGTGGATAAAGGTAGTAGGAATGTGACTCCCCCGGGAGTGTTATAGCCTATTATTGCATACACTGGGTGAGACTGAGGACTGCAGCTCGCCTTTTGGCCGGTCTTCGGACACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGAC


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAAAGCTCAAATTTGTAATCTGGCTGTCTTCGATAGTCCGAGTTGTAATCTATAGACGTGTTTTCCGTGCTGGACCGTATCTAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGACAATCCCGTGCTTGATACGACCACCAGTGCTCTGTGATACACGTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTCTTCAGATTCAGCTGGTTCTTCCAGTCTACTTCTGTGGAACGGGTCAACATCAGTTTTGTCCGGTGGATAAAGGTAGTAGGAATGTGACTCCCCCGGGAGTGTTATAGCCTATTATTGCATACACTGGGTGAGACTGAGGACTGCAGCTCGCCTTTTGGCCGGTCTTCGGACACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGACCCGTC

Verification method
Whole-genome Sequencing

History

Deposited as
Candida curvata
Synonyms
Trichosporon oleaginosus Zhou et al., Trichosporon oleaginosum Zhou et al.
Depositors
Iowa State Univ. Res. Fndn.
Chain of custody
ATCC <-- Iowa State Univ. Res. Fndn. <-- NJ Moon
Patent depository
This material was deposited with the ATCC Patent Depository to fulfill U.S. or international patent requirements. This material may not have been produced or characterized by ATCC.  As an International Depository Authority (IDA) for patent deposits, ATCC is required to complete viability testing only at time of initial deposit of patent material. Patent deposits are made available on behalf of the Depositor when the pertinent U.S. or international patent is issued, but material may not be used to infringe the patent claims.
Patent number
4,235,933
Cross references
GenBank Y12080 A.curvatum mRNA for SIS1 protein.
GenBank Y10421 C.curvatus strain ATCC 20509 Ole1 gene.
GenBank Y12079 A.curvatum mRNA for heat shock protein 70.
GenBank HM802135 ITS including 5.8S rRNA gene and D1/D2 region of 26S rRNA gene
GenBank MATS00000000 Cutaneotrichosporon curvatus strain ATCC 20509, whole genome shotgun sequencing project

Legal disclaimers

Intended use
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.
Warranty

The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Disclosures
This material is cited in a US and/or international patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Depositor of the party to which the material was furnished.

Permits & Restrictions

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

Frequently Asked Questions

References

Curated Citations

Yu X, et al. Oil production by oleaginous yeasts using the hydrolysate from pretreatment of wheat straw with dilute sulfuric acid. Bioresour. Technol. 102: 6134-6140, 2011. PubMed: 21463940

Gujjari P, et al. Characterization of oleaginous yeasts revealed two novel species: Trichosporon cacaoliposimilis sp. nov. and Trichosporon oleaginosus sp. nov. Mycologia. 103:1110-1118, 2011. PubMed: 21558504

Hassan M, et al. Influence of nitrogen and iron limitations on lipid production by Cryptococcus curvatus grown in batch and fed-batch culture. Process Biochem. 31: 355-361, 1996.

Bednarski W, et al. Utilization of beet molasses and whey for fat biosynthesis by a yeast. Agric. Wastes 18: 19-26, 1986.

Brown BD, et al. A relationship between growth and lipid accumulation in Candida curvata D. J. Ferment. Bioeng. 68: 344-352, 1989.

View All Curated Citations for this Product

For product-related inquiries and issues, contact Product Experience:

Message Us

Hours of Operation

Monday - Friday
9:00am - 5:00pm
US Eastern Time