ATCC 100 Years Logo Anniversary ATCC 100 Years Logo Anniversary Cart 0
SearchLoading
  • Quick Order
  • Careers
  • Support
  • Quick Order

Teunomyces barrocoloradensis (Suh et al.) Kurtzman et Blackwell

MYA-4352

An ampoule containing viable cells (yeast cells, spores, or agar cubes with mycelia) suspended in cryoprotectant.
Product category
Fungi
Product type
Yeast
Classification
Fungi, Ascomycota, Saccharomycotina, Saccharomycetes, Saccharomycetidae, Saccharomycetales, Teunomyces
Strain designation
BG 05-8-1-005A-1-1 [CBS 10310, NRRL Y-27934]
Type strain
Yes
Isolation source
Gut of Pallodes sp. (Nitidulidae) ex Gerronema sp.
Geographical isolation
Panama; Barro Colorado Island
Product format
Frozen
Storage conditions
-80°C or colder
Buy Now
Price: $639.00 EA
Discounts may be available for our fellow nonprofit organizations. Login to see your price.

Generally ships within 1-3 business days

Documentation

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.

Detailed product information

General

Preceptrol
No

Characteristics

Comments
Insect associated yeast. Isolated from digestive tract of tropical mushroom-feeding beetle.

Handling information

Medium
Temperature
24-26°C
Atmosphere
Aerobic
Handling procedure
Frozen ampoules packed in dry ice should either be thawed immediately or stored in liquid nitrogen. If liquid nitrogen storage facilities are not available, frozen ampoules may be stored at or below -70°C for approximately one week. Do not under any circumstance store frozen ampoules at refrigerator freezer temperatures (generally -20°C). Storage of frozen material at this temperature will result in the death of the culture.

  1. To thaw a frozen ampoule, place in a 25°C to 30°C water bath, until just thawed (approximately 5 minutes).  Immerse the ampoule just sufficient to cover the frozen material.  Do not agitate the ampoule.
  2. Immediately after thawing, wipe down ampoule with 70% ethanol and aseptically transfer at least 50 µL (or 2-3 agar cubes) of the content onto a plate or broth with medium recommended.
  3. Incubate the inoculum/strain at the temperature and conditions recommended. Inspect for growth of the inoculum/strain regularly. The sign of viability is noticeable typically after 1-2 days of incubation. However, the time necessary for significant growth will vary from strain to strain.
Handling notes
Additional information on this culture is available on the ATCC® web site at www.atcc.org.

Quality control specifications

Sequenced data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TTACTCCACGTGTTTTTTATGACATAAATTATTAATTATTATGAATATCAATATTTTTAAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTATTATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCACAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAGCTTTTAGCTTGGTGTTGAGTTTGCTCGGCTTACTTGAAAAATATGTCTGTAATTGTTTAGGTTCTACCAAATCTTTTACACTAATCCAAGTTTGACCTCAAATCAGGTAG


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTCCGTAAGGCGAGTTGTAATTTGAAGAAGCAACTTTGGACTGGTGCCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGGACCACCAGGCCATGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTGACTCGTCACTGGGCCAGCATCGGTTTGGGTGGTAGGACAATACCGTAGGAACGTAGCTCATTGAGTGTTATAGCCTGCGGGGATACTGCCTATCCAGACCGAGGACTGCGGCAACTAGGATGCTGGCATAATGATCTTAAGCCGC

History

Deposited as
Candida barrocoloradensis Suh et al.
Synonyms
Candida barrocoloradensis Suh et al.
Depositors
SO Suh
Chain of custody
ATCC <-- SO Suh
Type of isolate
Arthropod
Special collection
NSF - Mycology
Cross references
GenBank FJ614688 D1/D2 region of 28S rRNA gene
GenBank FJ172254 ITS including 5.8S rRNA gene

Legal disclaimers

Intended use
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.
Warranty

The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Permits & Restrictions

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

Frequently Asked Questions

References

Curated Citations

Suh SO, Nguyen NH, Blackwell M. A yeast clade near Candida kruisii uncovered: nine novel Candida species associated with basidioma-feeding beetles. Mycol. Res. 110: 1379-1394, 2006. PubMed: 17113766

Kurtzman CP, Robnett CJ, Blackwell M. Description of Teunomyces gen. nov. for the Candida kruisii clade, Suhomyces gen. nov. for the Candida tanzawaensis clade and Suhomyces kilbournensis sp. nov. FEMS Yeast Res 16(5). pii: fow041, 2016. PubMed: 27188882

For product-related inquiries and issues, contact Product Experience:

Message Us

Hours of Operation

Monday - Friday
9:00am - 5:00pm
US Eastern Time