pENTR_L1L2_PhlF
SB-1032 ™
pENTR_L1L2_PhlF contains a PhlF gene (TetR homolog) flanked by two Gateway® recombination att sites (attL1 and attL2). PhlF, a transcriptional regulator from Pseudomonas bacteria, can repress gene transcription by binding its cognate operator sequence (ATGATACGAAACGTACCGTATCGTTAAGGT) and occluding polymerase activity. It is one of regulators in the ATCC® Synthetic Biology Yeast Tool Kit. The synthetic promoter pGPD- PhlF (ATCC® SB-1070™) can be paired with this regulator for the control of gene expression in Saccharomyces cerevisiae (Detailed information is described in the ATCC® Synthetic Biology Solutions User Guide). Gateway® is a registered trademark of Thermo Fisher Scientific.