Filobasidiella neoformans Kwon-Chung, teleomorph (ATCC® 28957)

Strain Designations: [CBS 6885, NRRL Y-17397]  /  Product Format: freeze-dried

Strain Designations [CBS 6885, NRRL Y-17397]
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain yes (type strain, mating type alpha)
Antigenic Properties serotype D RefKwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816
Preceptrol® no
Mating Type mates with ATCC 28958 mating type alpha self-fertile mates with ATCC 28958 RefSchmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981. , RefKwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATATTGGACTTTGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCATATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAA

Name of Depositor KJ Kwon-Chung
Isolation
human bone lesion
References

Schmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981.

Kwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816

type strain, mating type alpha

type strain, mating type alpha

Kwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816

Schmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981.

Kwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816