Komagataella pastoris (Guilliermond) Yamada et al. (ATCC® 28485)

Strain Designations: CBS 704 [CCRC 21531, DSMZ 70382, JCM 3650, NCYC 175, NRRL Y-1603]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Pichia pastoris (Guilliermond) Phaff, teleomorph
Strain Designations CBS 704 [CCRC 21531, DSMZ 70382, JCM 3650, NCYC 175, NRRL Y-1603]
Application
Degrades ethyl alcohol ethanol
Degrades hydrogen peroxide
Produces acetaldehyde
Produces alcohol oxidase
Produces single-cell protein SCP
Produces single-cell protein from oxygenated hydrocarbons
Produces natural flavor aldehydes
Converts ethanol to acetaldehyde
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes RefPhaff HJ. A proposal for amendment of the diagnosis of the genus Pichia Hansen. Antonie van Leeuwenhoek 22: 113-116, 1956. , RefYamada Y, et al. The phylogenetic relationships of methanol-assimilating yeasts based on the partial sequences of 18S and 26S ribosomal RNAs: the proposal of Komagataella gen. nov. (Saccharomycetaceae). Biosci. Biotechnol. Biochem. 59: 439-444, 1995. PubMed: 7766181
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Pichia pastoris is a synonym for Komagaraella pastoris.
Morphology After 3 days cells are spheroidal to ovoidal, and occur singly or in pairs.  Growth is cream-colored, dull to faintly glistening and butyrous.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
26S ribosomal RNA gene, partial sequence

AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGTCCACCTTTGAAGTATTGACGTGGTTGGGAGAGGTTATTGCACAAGTCGCCTGGAACGGCCGCCAAAGAGGGTGATAGCCCCGTAGCATACAACCAATCTTCCCAGCCGACAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAAGGTGGTAGGGTCCATCAAAGACTAAATATCAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAACAGTGCGTGAAATTGGGGGGAGGGAAGGCAAGGCCACGACAGTGGTCCTGCGCCCGTCTTGAAACACGG

Morphology After 3 days cells are spheroidal to ovoidal, and occur singly or in pairs.  Growth is cream-colored, dull to faintly glistening and butyrous.
Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- A Guilliermond
Isolation
Exudate of oak; France
Cross References

Nucleotide (GenBank) : JQ070155 D1/D2 region of 28S rRNA gene

References

Agric. Biol. Chem. 54: 1879-1882, 1990.

. . Appl. Microbiol. Biotechnol. 36: 82-86, 1991.

Duff SJ, Murray WD. Comparison of free and immobilized Pichia pastoris cells for conversion of ethanol to acetaldehyde. Biotechnol. Bioeng. 31: 790-795, 1988.

Duff SJ, Murray WD. Oxidation of benzyl alcohol by whole cells of Pichia pastoris and by alcohol oxidase in aqueous and nonaqueous reaction media. Biotechnol. Bioeng. 34: 153-159, 1989.

Duff SJ, Murray WD. Production and application of methylotrophic yeast Pichia pastoris. Biotechnol. Bioeng. 31: 44-49, 1988.

Duff SJB, et al. Production of natural flavor aldehydes from natural source primary alcohols C2-C7. US Patent 4,871,669 dated Oct 3 1989

Duff SJ, Murray WD. Production of flavor aldehydes using nongrowing whole cells of Pichia pastoris. Ann. N.Y. Acad. Sci. 542: 428-433, 1988.

. . Enzyme Microb. Technol. 11: 770-775, 1989.

Mattanovich D, et al. Genome, secretome and glucose transport highlight unique features of the protein production host Pichia pastoris. Microb. Cell Fact. 8: 29, 2009.

Murray WD, et al. Catabolite inactivation in the methylotrophic yeast Pichia pastoris. Appl. Environ. Microbiol. 56: 2378-2383, 1990.

Murray WD, et al. Induction and stability of alcohol oxidase in the methylotrophic yeast Pichia pastoris. Appl. Microbiol. Biotechnol. 32: 95-100, 1989.

Murray WD, Duff SJB. Metabolism of hydrogen peroxide by Pichia pastoris. Agric. Biol. Chem. 54: 1967-1974, 1990.

Phaff HJ. A proposal for amendment of the diagnosis of the genus Pichia Hansen. Antonie van Leeuwenhoek 22: 113-116, 1956.

Wegner EH. Treatment of make-up water for use in a fermentation process for growth of yeast cells requiring growth factors. US Patent 4,226,939 dated Oct 7 1980

Yamada Y, et al. The phylogenetic relationships of methanol-assimilating yeasts based on the partial sequences of 18S and 26S ribosomal RNAs: the proposal of Komagataella gen. nov. (Saccharomycetaceae). Biosci. Biotechnol. Biochem. 59: 439-444, 1995. PubMed: 7766181

Phaff HJ. A proposal for amendment of the diagnosis of the genus Pichia Hansen. Antonie van Leeuwenhoek 22: 113-116, 1956.

Yamada Y, et al. The phylogenetic relationships of methanol-assimilating yeasts based on the partial sequences of 18S and 26S ribosomal RNAs: the proposal of Komagataella gen. nov. (Saccharomycetaceae). Biosci. Biotechnol. Biochem. 59: 439-444, 1995. PubMed: 7766181

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation