Candida tropicalis (Castellani) Berkhout

750 ^™

Download Genome Learn about the ATCC Genome Portal

An ampoule containing viable cells (may include yeast cells, pseudohyphae, true hyphae) suspended in cryoprotectant.

Product category: Fungi
Product type: Yeast

Preceptrol culture
Strain designation: [1909, ATCC 4563, ATCC 7349, CBS 94, CCRC 20520, IFO 1070, IFO 1400, JCM 1541, NRRL Y-12699, NRRL Y-12968, NRRL Y-607]
Type strain: Yes
Genome sequenced strain: Yes
Isolation source: Patient with bronchomycosis
Product format: Freeze-dried
Storage conditions: 2°C to 8°C

See Additional Product Information

Price: $84.00 EA

Discounts may be available for our fellow nonprofit organizations. Login to see your price.

Generally ships within 1-3 business days

Documentation

Product sheet

BSL 1

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.

General

Specific applications: Assay of chloro-8-quinolinol

Bacterial resistance testing

Degrades xylose D-xylose

Fungus resistance testing adhesives

Produces aspartic proteinases aspartyl proteinases

Produces ethyl alcohol ethanol

Produces xylitol

Susceptibility disc testing

Susceptibility testing

Produces xylitol from D-xylose

Control strain for typing systems

Produces ethanol from D-xylose

Control strain to test oxygen availability in bioreactor in space laboratory

Reference strain for Clinical and Laboratory Standards Institute(CLSI)-developed Antifungal Susceptibility Testing.
Preceptrol: Yes

Characteristics

Ploidy: Diploid
Comments: Fluconazole-sensitive
Utilizes phenol, catechol and 3- and 4-methylcatechols as sole carbon source
Esterase activity
MIC of 2-hydroxychalcone, 75 mcg/ml
Adherence to lysophospholipids
Genome sequencing strain (Genolevures Consortium, France; Wellcome Trust Sanger Institute, UK).
For additional infromation, see CLSI M27-A2 (Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts; Approved Standards-Second Edition).
Mitochondrial genome sequenced strain
Technical information: ATCC Technical Services does not have technical information on patent deposits that are not produced or characterized by ATCC. Additional information can be found in the corresponding patent available from the patent holder or with the U.S. and/or international patent office.

Handling information

Medium

ATCC Medium 200: YM agar or YM broth

ATCC Medium 1245: YEPD

ATCC Medium 28: Emmons' modification of Sabouraud's agar/broth

Temperature

24-26°C

Atmosphere

Aerobic

Handling procedure

For freeze-dry (lyophilized) ampoules:

Open an ampoule according to enclosed instructions.
From a single test tube of sterile distilled water (5 to 6 mL), withdraw approximately 0.5 to 1.0 mL with a sterile pipette and apply directly to the pellet. Stir to form a suspension.
Aseptically transfer the suspension back into the test tube of sterile distilled water.
Let the test tube sit at room temperature (25°C) undisturbed for at least 2 hours; longer (e.g., overnight) rehydration might increase viability of some fungi.
Mix the suspension well. Use several drops (or make dilutions if desired) to inoculate recommended solid or liquid medium. Include a control that receives no inoculum.
Incubate the inoculum at the propagation conditions recommended.
Inspect for growth of the inoculum/strain regularly. The sign of viability is noticeable typically after 1 to 2 days of incubation. However, the time necessary for significant growth will vary from strain to strain.

Handling notes

Type strain.
Additional, updated information on this product may be available on the ATCC^® web site at www.atcc.org.

Quality control specifications

Sequenced data

18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTTATTGAACAAATTTCTTTGGTGGCGGGAGCAATCCTACCGCCAGAGGTTATAACTAAACCAAACTTTTTATTTACAGTCAAACTTGATTTATTATTACAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCCCGGGTTTGGTGTTGAGCAATACGCTAGGTTTGTTTGAAAGAATTTAACGTGGAAACTTATTTTAAGCGACTTAGGTTTATCCAAAAACGCTTATTTTGCTAGTGGCCACCACAATTTATTTCATAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGATCCAGGCCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTTCTTCGGGGGTGGCCTCTACAGTTTATCGGGCCAGCATCAGTTTGGGCGGTAGGAGAATTGCGTTGGAATGTGGCACGGCTTCGGTTGTGTGTTATAGCCTTCGTCGATACTGCCAGCCTAGACTGAGGACTGCGGTTTATACCTAGGATGTTGGCATAATGATCTTAAGTCGC

Verification method

Whole-genome Sequencing

History

Deposited as: Monilia tropicalis (Castellani) Castellani et Chalmers
Synonyms: Candida benhamii Novak et Vitez; Candida vulgaris Berkhout; Monilia murmannica Plevako et Cheban; Mycotorula japonica Yamaguchi; Trichosporon lodderi Phaff et al.
Depositors: A Castellani
Patent depository: This material was deposited with the ATCC Patent Depository to fulfill U.S. or international patent requirements. This material may not have been produced or characterized by ATCC. As an International Depository Authority (IDA) for patent deposits, ATCC is required to complete viability testing only at time of initial deposit of patent material. Patent deposits are made available on behalf of the Depositor when the pertinent U.S. or international patent is issued, but material may not be used to infringe the patent claims.
Type of isolate: Human
Cross references: GenBank KU729064 ITS including 5.8S rRNA gene

GenBank KU729147 D1/D2 region of 26S rRNA gene

GenBank AX110837 Sequence 1570 from Patent WO0123604.

GenBank U45749 26S ribosomal RNA gene, partial sequence

GenBank M60308 C. tropicalis small subunit ribosomal RNA.

GenBank M23673 Candida tropicalis (ATCC 750) cytochrome P450 lanosterol

GenBank AF194419 Candida tropicalis multidrug resistance protein (MDR1) gene,

GenBank AF218992 Candida tropicalis strain ATCC 750T 5.8S ribosomal RNA gene,

GenBank M15945 Yeast (C. tropicalis) P450alk gene encoding the alkane-inducible

GenBank M35199 C. tropicalis NADPH-cytochrome P450 reductase gene, complete cds.

GenBank M24894 Candida tropicalis alkane-inducible cytochrome P450 gene, complete

GenBank U00675 Candida tropicalis D-arabinitol dehydrogenase (ARD) gene, complete

Legal disclaimers

Intended use

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.

Warranty

The product is provided 'AS IS' and the viability of ATCC^® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid. Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Disclosures

This material is cited in a US and/or international patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Depositor of the party to which the material was furnished.

Permits & Restrictions

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

References

Curated Citations

Mahmourides, G et al. Ethanol accumulation in cultures of Pachysolen tannophilus on D-xylose is associated with a transition to a state of low oxygen consumption. Bio-Technology 3: 59-62, 1985.

Walther I, et al. Development of a miniature bioreactor for continuous culture in a space laboratory. J Biotechnol 38: 21-32, 1994. PubMed: 7765579

Sato M, et al. Growth inhibitory properties of chalcones to Candida. Lett Appl Microbiol 18: 53-55, 1994.

Rudek W. Esterase activity in Candida species. J Clin Microbiol 8: 756-759, 1978. PubMed: 370150

Castellani A. Observations on "tropical broncho-oidiosis". Br Med J 2: 868-869, 1910.

View All Curated Citations for this Product

Need assistance with this product? Contact our Technical Support team.

Email

Send us a message

Telephone

US and Puerto Rico

800-638-6597

Outside the US

+1-703-365-2700

Hours of Operation

Monday-Friday

9:00am - 5:00pm
US Eastern Time