Candida viswanathii Sandhu et Randhawa
20336 ™
Download Genome Learn about the ATCC Genome Portal
An ampoule containing viable cells (may include spores and mycelia) suspended in cryoprotectant.
- Product category
-
Fungi
- Product type
-
Yeast
- Strain designation
- PK 233 [NCYC 997, pK233]
- Type strain
- No
- Genome sequenced strain
- Yes
- Product format
- Freeze-dried
- Storage conditions
-
2°C to 8°C
Documentation
Product sheet
ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.
ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.
Detailed product information
General
- Specific applications
-
Degrades catalaseDegrades hydrocarbonsProduces alcohol oxidaseProduces carnitine acetyltransferaseProduces ergosterolProduces ubiquinone-9Produces urate oxidase uricaseUsed in recycle type, continuous process for fermentation based on application of mixed culturing principleProduces thiolase III in peroxisomesProduces ergosterol and ubiquinone-9 in a single processProduces extracellular mannon
- Preceptrol
- No
Characteristics
- Morphology
- On YM agar at 25°C after 10 days, colonies creamy white to dingy white, butryous, smooth, slightly raised, margin filamentous. Cells subglobose to ovoid, smooth, guttulate, 9-12 X 5-7.5µm. Pseudohyphae present.
- Comments
-
Catalase activityFatty acid beta-oxidationCharacterization of peroxisomes
- Technical information
-
ATCC Product Experience does not have technical information on patent deposits that are not produced or characterized by ATCC. Additional information can be found in the corresponding patent available from the patent holder or with the U.S. and/or international patent office.
Handling information
- Medium
- Temperature
-
24-26°C
- Atmosphere
-
Aerobic
- Handling procedure
-
For freeze-dry (lyophilized) ampoules:
- Open the ampoule.
- From a single test tube of sterile distilled water (5 to 6 mL), withdraw approximately 0.5 to 1.0 mL with a sterile pipette and apply directly to the pellet. Stir to form a suspension.
- Aseptically transfer the suspension back into the test tube of sterile distilled water.
- Let the test tube sit at room temperature (25°C) undisturbed for at least 2 hours; longer (e.g., overnight) rehydration might increase viability of some fungi.
- Mix the suspension well. Use several drops (or make dilutions if desired) to inoculate recommended solid or liquid medium. Include a control that receives no inoculum.
- Incubate the inoculum at the propagation conditions recommended.
- Inspect for growth of the inoculum/strain regularly. The sign of viability is noticeable typically after 1-2 days of incubation. However, the time necessary for significant growth will vary from strain to strain.
- Handling notes
- Additional information on this culture is available on the ATCC® web site at www.atcc.org.
Quality control specifications
- Sequenced data
-
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
GGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCACTGGACAGCTGCTTTGGCGGGGGGACTCGTTTCCGCCGCCAGAGGTCACAACTAAACCAAACTTTTTATTACCAGTCAACCATACGTTTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAGCCCGCGGGTTTGGTGTTGAGCAATACGCCAGGTTTGTTTGAAAGACGTACGTGGAGACTATATTAGCGACTTAGGTTCTACCAAAACGCTTGTGCAGTCGGCCCACCACAGCTTTTCTAACTTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA
D1D2 region of the 26S ribosomal RNA gene:ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCAGGTCCGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGCATTTTGCATGTTGCTTCTTCGGGGGCGGCCTCTGCGGTTTGTCGGGCCAGCATCAGTTTGGGCGG
- Verification method
-
Whole-genome Sequencing
History
- Deposited as
- Candida tropicalis (Castellani) Berkhout
- Depositors
- Kyowa Ferm. Ind. Co., Ltd.
- Chain of custody
- ATCC <-- Kyowa Ferm. Ind. Co., Ltd.
- Patent depository
-
This material was deposited with the ATCC Patent Depository to fulfill U.S. or international patent requirements. This material may not have been produced or characterized by ATCC. As an International Depository Authority (IDA) for patent deposits, ATCC is required to complete viability testing only at time of initial deposit of patent material. Patent deposits are made available on behalf of the Depositor when the pertinent U.S. or international patent is issued, but material may not be used to infringe the patent claims.
- Patent number
-
3,767,534
- Cross references
-
GenBank X05604 Candida tropicalis mRNA for catalase.GenBank M18832 C.tropicalis peroxisomal catalase mRNA, complete cds.GenBank AB025647 nucleotide sequence of the promoter region of CT-T3AGenBank AB025648 nucleotide sequence of the promoter region of CT-T3BGenBank M18259 C.tropicalis POX2 gene encoding PXP-2 protein, complete cds.GenBank M12161 Candida tropicalis acyl-coenzyme A oxidase I precursor, gene,GenBank S77426 ICL=isocitrate lyase gene {promoter} [Candida tropicalis, pK233,GenBank M24440 Candida tropicalis (ATCC 20336)small aleate-inducible peroxisomalGenBank M12160 Yeast (C.tropicalis) POX4 gene encoding acyl-coenzyme A oxidase IIGenBank KU729067 ITS including 5.8S rRNA geneGenBank KU729150 D1/D2 region of 28S rRNA gene
Legal disclaimers
- Intended use
- This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.
- Warranty
-
The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid. Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.
- Disclaimers
-
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.
While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.
This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.
Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.
- Disclosures
-
This material is cited in a US and/or international patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Depositor of the party to which the material was furnished.
Permits & Restrictions
Import Permit for the State of Hawaii
If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.
Frequently Asked Questions
References
Curated Citations
Eirich LD, et al. Cloning and characterization of three fatty alcohol oxidase genes from Candida tropicalis strain ATCC 20336. Appl Environ Microbiol 70: 4872-4879, 2004. PubMed: 15294826
Torkko JM, et al. Candida tropicalis expresses two mitochondrial 2-enoyl thioester reductases that are able to form both homodimers and heterodimers. J Biol Chem 278: 41213-41220, 2003. PubMed: 12890667
Kamauchi S, et al. Structurally and functionally conserved domains in the diverse hydrophilic carboxy-terminal halves of various yeast and fungal Na+/H+ antiporters (Nha1p). J. Biochem. 131: 821-831, 2002. PubMed: 12038978
Kato M, et al. Phylogenetic relationship and mode of evolution of yeast DNA topoisomerase II gene in the pathogenic Candida species. Gene 272: 275-281, 2001. PubMed: 11470534
Kanai T, et al. An n-alkane-responsive promoter element found in the gene encoding the peroxisomal protein of Candida tropicalis does not contain a C(6) zinc cluster DNA-binding motif. J Bacteriol 182: 2492-2497, 2000. PubMed: 10762250
Powered by Bioz
For product-related inquiries and issues, contact Product Experience:
Hours of Operation
Monday - Friday
9:00am - 5:00pm
US Eastern Time
US Eastern Time
