ATCC 100 Years Logo Anniversary ATCC 100 Years Logo Anniversary Cart 0
  • Quick Order
  • Careers
  • Support

Aspergillus brasiliensis Varga et al.

16404-MINI-PACK

ATCC® 16404-MINI-PACK™ consists of 6 ready-to-use vials of ATCC® 16404™ frozen in 200 µL of glycerol stock, eliminating the need to rehydrate and culture the strain prior to use. Each vial is provided with a 2-D barcode for easy storage and tracking, as well as peel-off labels for fast and reliable recordkeeping.
Product category
Fungi
Classification
Fungi, Dikarya, Ascomycota, Pezizomycotina, Eurotiomycetes, Eurotiomycetidae, Eurotiales, Aspergillaceae, Aspergillus
Strain designation
WLRI 034(120) [CBS 733.88, DSM 1387, DSM 1988, IFO 9455, IMI 149007, NCPF 2275]
Genome sequenced strain
Yes
Isolation source
Blueberry
Geographical isolation
United States; North Carolina
Applications
Food testing
Media testing
Quality control
Bioremediation
Product format
Frozen
Shipping information
6 ready-to-use vials containing the strain in glycerol stock
Storage conditions
-80°C or colder
Buy Now
Price: $261.00 EA
Discounts may be available for our fellow nonprofit organizations. Login to see your price.

Generally ships within 1-3 business days

Documentation

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.

Detailed product information

General

Specific applications
ATCC® 16404-MINI-PACK™ consists of 6 ready-to-use vials of ATCC® 16404™ frozen in 200 µL of glycerol stock, eliminating the need to rehydrate and culture the strain prior to use. Each vial is provided with a 2-D barcode for easy storage and tracking, as well as peel-off labels for fast and reliable recordkeeping. Developed by the leaders in microbial cultivation and preservation, ATCC® Minis provide a convenient, ready-to-use solution for handling quality control strains. ATCC® Minis are authenticated and backed by ATCC polyphasic testing – ensuring the same consistent and reliable reference materials you’ve come to trust for ATCC Genuine Cultures®. It is easy to ensure the quality of your products with ATCC® Minis – just open, plate, and go! 

Assay of antimicrobial preservatives
Media testing
Preparatory test control
Quality control strain
Sterility testing
Testing fungicides
Transformation host
Validation control
Reference strain for performance testing culture media listed by the ISO TC 34 SC 9 Joint Working Group 5 in the ISO 11133 and by the Working Party on Culture Media of the International Committee on Food Microbiology and Hygiene (ICFMH-WPCM)
Food testing
Pharmaceutical and Personal Care
Growth promotion testing
Bioburden testing
Environmental monitoring
Preservative efficacy testing
Antimicrobial effectiveness testing
Disinfectant testing
Aseptic processing
Potential bioremediation agent: phenolic compounds, melanoidin
Preceptrol
No

Characteristics

Morphology
Colonies initially white or yellowish, mycelium growing rapidly producing a dense layer of erect smooth-stiped, conidiophores terminated by globose vesicles bearing phialides (uniseriate) or metulae with phialides (biseriate) which produce dry chains of conidia. Reverse pale to grayish or greenish yellow. Vesicles radiate, initially pale, becoming dark brown to black. Conidia spherical, mid-to-dark brown, highly roughened with ridges and blunt or pointed protuberances, (3-)4-5(-6) µm in diameter.
Sporulation may be inhibited when grown in vessels with reduced gas exchange. Colonies may exhibit sectoring with areas of varying levels of sporulation. Use of freshly produced spores as inoculum should reduce sectoring.
Comments
This strain is recommended by ATCC for use in the tests described in ASTM Standard Test Method E979-91 where only the taxon is specified.
This strain was recently re-named as Aspergillus brasiliensis.
Use of impedance for preservative efficacy testing

Handling information

Medium
Temperature
20-25°C
Atmosphere
Aerobic
Handling procedure
Frozen mini-cryovials packed in dry ice should either be thawed immediately for use or stored at or below
-70°C until the expiration date printed on the label. Short-term storage at -20°C is acceptable for up to 9 months.

  1. To thaw a frozen mini-cryovial, place the vial upright in a 25°C to 30°C water bath, until just thawed (approximately 2-3 minutes).  Immerse the mini-cryovial just sufficient to cover the frozen material.  Do not agitate the mini-cryovial.
  2. Immediately after thawing, wipe down the mini-cryovial with 70% ethanol and aseptically transfer at least 50 µL (or 2-3 agar cubes) of the content onto a plate or broth with the recommended medium.
  3. Discard the empty vial. Do not refreeze any unused portion as it will result in a loss of viability.
  4. Incubate the inoculum/strain at the temperature and conditions recommended. Inspect for growth of the inoculum/strain regularly. Viability is typically noticeable after 2-3 days of incubation. However, the time necessary for significant growth will vary from strain to strain.

 

Handling notes
This strain was identified as belonging to the new species Aspergillus brasiliensis (see Varga et al. 2007 and Houseknecht et al., 2008.)
Additional, updated information on this product may be available on the ATCC® web site at www.atcc.org.

Quality control specifications

Sequenced data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACCCTGTCTGAAAGCGTGCAGTCTGAGTCGATTGTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCTCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S Ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGAGTCCGCATTGTAATTTGCAGAGGATGCTTTGGGTGCGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGGTGTCCGTGCCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCTGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCAGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGAC

Verification method
Whole-genome Sequencing

History

Deposited as
Aspergillus niger van Tieghem
Depositors
SM Ringel
Type of isolate
Food & Beverage; Plant
Special collection
ATCC® Minis
Cross references
GenBank KU729174 D1/D2 region of 28S rRNA gene
GenBank FJ195348 ITS including 5.8S rRNA gene

Legal disclaimers

Intended use
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.
Warranty

The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Permits & Restrictions

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

Frequently Asked Questions

References

Curated Citations

Connolly P, et al. The use of impedance for preservative efficacy testing of pharmaceuticals and cosmetic products. J. Appl. Bacteriol. 76: 68-74, 1994. PubMed: 8144407

Wnendt S, et al. Molecular cloning, sequence analysis and expression of the gene encoding an antifungal-protein from Aspergillus giganteus. Curr. Genet. 25: 519-523, 1994. PubMed: 8082203

ASTM International Standard Test Method for Preservatives in Water-Containing Cosmetics. West Conshohocken, PA

British Pharmacopoeia Commission Test for sterility. London, UK:British Pharmacopoeia Commission;British Pharmacopoeia Appendix XVI A, 2003

British Pharmacopoeia Commission Tests for microbial contamination. London, UK:British Pharmacopoeia Commission;British Pharmacopoeia Appendix XVI B, 2003

View All Curated Citations for this Product

For product-related inquiries and issues, contact Product Experience:

Message Us

Hours of Operation

Monday - Friday
9:00am - 5:00pm
US Eastern Time