American Type Culture Collection (ATCC) Logo American Type Culture Collection (ATCC) Logo Cart 0
  • Quick Order
  • Careers
  • Support

pDEST23y

SB-1001

pDEST23y is a Saccharomyces cerevisiae/Escherichia coli shuttle vector in the ATCC® Synthetic Biology Yeast Tool Kit. It contains two Gateway® recombination att sites (attR2 and attR4) for the assembly of a promoter and a gene via the Gateway® LR reaction (Gateway® Technology User Manual). For the detailed Gateway® reaction, please refer to the manufacturer’s instructions. A CYC1 transcriptional terminator is located downstream of attR2. The transcription unit (TU), consisting of a promoter, a gene, and the terminator, can be released from the vector by a rare-cut restriction enzyme, I-SceI. Two 45 bp unique nucleotide sequences (UNS-2: GGTGCGTTTTTATGCTTGTAGTATTGTATAATGTTTTTAAGATCC and UNS-3: GGTCTAATACCCAATCTCTCGTCTTATCCAGATGTTTTATACGCC) in the vector flanking the TU determine the TU’s position for building multiple transcription units (detail information is described in the ATCC® Synthetic Biology Solutions User Guide).

Product type
Yeast
Applications
Genetic engineering
Industrial biotechnology
Storage conditions
2°C to 8°C
Buy Now
Price: $655.00 ea
Discounts may be available for our fellow nonprofit organizations. Login to see your price.

Generally ships within 1-3 business days

Documentation

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

Required Products

These products are vital for the proper use of this item and have been confirmed as effective in supporting functionality. If you use alternative products, the quality and effectiveness of the item may be affected.

Detailed product information

General

Specific applications
A destination vector in the ATCC® Synthetic Biology Yeast Tool Kit designed for use in the development of a single transcription unit

Characteristics

Comments
This plasmid is a Saccharomyces cerevisiae/Escherichia coli shuttle vector. It contains a HIS3 marker for yeast selection. A ccdB gene, located within two att sites, can improve the Gateway® cloning efficiency.
Gateway® is a registered trademark of Thermo Fisher Scientific

Vector information

Construct size (kb)
6.419
Type of vector
Destination vector
Markers
cmR; ampR

Handling information

Handling procedure

Before opening the vial, centrifuge at 6,000 x g for 30 seconds. Add 30 µL of Molecular Grade Water and incubate the vial at 4°C overnight to dissolve the DNA. Each vial contains 2-3 µg plasmid DNA (measured by PicoGreen® dsDNA quantitation assay).

Quality control specifications

Volume
2 μg to 3 μg

History

Depositors
R Weiss, Massachusetts Institute of Technology

Legal disclaimers

Intended use
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.
Warranty

The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Permits & Restrictions

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

Frequently Asked Questions

References

Curated Citations

Life Technologies™. Gateway® Technology User Manual. September 2003.

For product-related inquiries and issues, contact Product Experience:

Message Us

Hours of Operation

Monday - Friday
9:00am - 5:00pm
US Eastern Time