Candida guilliermondii (Castellani) Langeron et Guerra, anamorph (ATCC® 6260)

Alternate State: Yamadazyma guilliermondii (Wickerham) Billon-Grand, teleomorph  /  Strain Designations: [ATCC 7350, CBS 566, DBVPG 6140, IFO 10279, IGC 2730, JCM 1539, NRRL Y-324]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Monilia guilliermondii (Castellani) Castellani et Chalmers, anamorph
Strain Designations [ATCC 7350, CBS 566, DBVPG 6140, IFO 10279, IGC 2730, JCM 1539, NRRL Y-324]
Alternate State Yamadazyma guilliermondii (Wickerham) Billon-Grand, teleomorph
Application
Produces riboflavin vitamin B2
Quality control strain
Quality control strain for API products
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® yes
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Broad Institute, USA).
Sequenced Data
5.8S ribosomal RNA gene, partial sequence, internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

GATATGCTTAAGTTCAGCGGGTATTCCTACCTGATTTGAGGTCAAGCTTGTTTGGTTGTTGTAAGGCCGGGCCAACAATACCAGAAATATCCCGCCACACCATTCAACGAGTTGGATAAACCTAATACATTGAGAGGTCGACAGCACTATCCAGTACTACCCATGCCAATACTTTTCAAGCAAACGCCTAGTCCGACTAAGAGTATCACTCAATACCAAACCCGGGGGTTTGAGAGAGAAATGACGCTCAAACAGGCATGCCCTCTGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGAAAATCTGCAATTCATATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGAAGATTAATTCAAAATTTGACTAACTGTAAAAATAATTAAATTGTGTTTTGTTAAACCTCTGGCCCAACCTATCTCTAGGCCAAACCAAAGCAAGAGTTCTGTATCAAAAAGACACTGTGTGTAAGGTTTTTCGCCGCGCAGTTAAGCGCTGGCAAAAGAATACTGTAATGATCCTTCCGCA

Name of Depositor A Castellani
Isolation
Sputum from patient with bronchomycosis
Cross References

Nucleotide (GenBank) : M60304 C.guilliermondii small subunit ribosomal RNA.

Nucleotide (GenBank) : AF218967 Pichia guilliermondii strain ATCC 6260T 5.8S ribosomal RNA gene

Complete Genome (GenBank) : AAFM00000000 Meyerozyma guilliermondii ATCC 6260, whole genome shotgun sequencing project

References

Tanner FW Jr., et al. Riboflavin production by Candida species. Science 101: 180-181, 1945.

Castellani AJ. Observations on the fungi found in tropical bronchomycosis. Lancet 1: 13-15, 1912.

Thanos M, et al. Rapid identification of Candida species by DNA fingerprinting with PCR. J. Clin. Microbiol. 34: 615-621, 1996. PubMed: 8904425

API 20C AUX. bioMerieux.

Butler G, et al. Evolution of pathogenicity and sexual reproduction in eight Candida genomes. Nature 459: 657-662, 2009. PubMed: 19465905

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation