HCT116-SLC25A23-KO-c9

Cancer drug screening, oncology therapeutic development

Solute transporter carrier (SLC) knock out cell line.

HCT 116 cells were stably transduced with a pLentiCRISPRv2 vector expressing a gene-specific gRNA against SLC25A23 (ACGTGCACGAGTTGCGCCAG) and a puromycin resistance marker. Single cell clones were sorted, expanded and genotyped to identify KO clones.

-23 deletion in SLC25A23 gene

The base medium for this cell line is RPMI 1640 (Corning cat # 10-040-CV). To make the complete medium add 10% Fetal Bovine Serum (FBS; ATCC 30-2020).

To ensure the highest level of viability, thaw the vial and initiate the culture as soon as possible upon receipt. If upon arrival, continued storage of the frozen culture is necessary, it should be stored in liquid nitrogen vapor phase and not at -70° C. Storage at -70°C will result in loss of viability. 

1. Thaw the vial by gentle agitation in a 37°C water bath. To reduce the possibility of contamination, keep the O-ring and cap out of the water. Thawing should be rapid (approximately 2 minutes).
2. Remove the vial from the water bath as soon as the contents are thawed and decontaminate by dipping in or spraying with 70% ethanol. All of the operations from this point on should be carried out under strict aseptic conditions.
3. Transfer the vial contents to a centrifuge tube containing 9.0 mL complete culture medium. and spin at approximately 150 to 400 x g for 8 to 12 minutes.
4. Resuspend cell pellet with the recommended complete medium (see the specific batch information for the culture recommended dilution ratio). It is important to avoid excessive alkalinity of the medium during recovery of the cells. It is suggested that, prior to the addition of the vial contents, the culture vessel containing the complete growth medium be placed into the incubator for at least 15 minutes to allow the medium to reach its normal pH (7.0 to 7.6). pH (7.0 to 7.6).
5. Incubate the culture at 37° C in a suitable incubator. A 5% CO₂ in air atmosphere is recommended if using the medium described on this product sheet.

Volumes used in this protocol are for 75 cm² flask; proportionally reduce or increase amount of dissociation medium for culture vessels of other sizes. Corning^® T-75 flasks (catalog #430641) are recommended for subculturing this product.

1. Remove and discard culture medium.
2. Briefly rinse the cell layer with 0.25% (w/v) Trypsin- 0.53 mM EDTA solution to remove all traces of serum that contains trypsin inhibitor.
3. Add 2.0 to 3.0 mL of Trypsin-EDTA solution to flask and observe cells under an inverted microscope until cell layer is dispersed (usually within 5 to 15 minutes).
4. Note: To avoid clumping do not agitate the cells by hitting or shaking the flask while waiting for the cells to detach. Cells that are difficult to detach may be placed at 37°C to facilitate dispersal.
5. Add 6.0 to 8.0 mL of complete growth medium and aspirate cells by gently pipetting.
6. Add appropriate aliquots of the cell suspension to new culture vessels.
7. Cultures can be established between 2.0 x 10⁴ and 4.0 x 10⁴ viable cells/cm².
8. Incubate cultures at 37°C.

Interval: Maintain cultures at a cell concentration between 1.0 X 10⁴ and 4.0 X 10⁴ cell/cm².

Subcultivation Ratio: A subcultivation ratio of 1:3 to 1:8 is recommended

Medium Renewal: 2 to 3 times per week

85% RPMI 1640 + 10% FBS + 5% DMSO

Genotype: PCR amplification of genomic DNA extracted from test sample

followed by NGS to verify unique target gene alterations.

Specification: Sequencing is 100% match to the reference sequence. 

Giulio Superti-Furga 

(Principal Investigator)

CeMM Research Center for Molecular Medicine

of the Austrian Academy of Sciences.

Lazarettgasse 14, AKH BT 25.3

1090 Vienna, Austria

The product is provided 'AS IS' and the viability of ATCC^® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.