Saccharomyces cerevisiae Meyen ex E.C. Hansen (ATCC® MYA-4852)

Alternate State: Candida robusta Diddens et Lodder  /  Strain Designations: D7 [ATCC 201137]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Saccharomyces cerevisiae Hansen
Classification Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomycetaceae, Saccharomyces, cerevisiae
Strain Designations D7 [ATCC 201137]
Alternate State Candida robusta Diddens et Lodder
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Genotype MATa/MATα ade2-40/ade2-119 ilv1-92/ilv1-92 trp5-12/trp5-27
Preceptrol® no
Ploidy diploid
Comments
Metabolism of 5-methoxypsoraien
Induction of cytochrome p-450
This strain can grow on adenine droupout medium (appears white-creamy color).
Morphology After 5 days on YEPD at 25°C colonies are butyrous, light cream-colored and circular. The surface is smooth usually flat or raised and opaque. Cells are globose, ovoidal or elongate and are usually isolated or in small groups.  
Medium ATCC® Medium 1245: YEPD
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAAATTTAATAATTTTGAAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC

Morphology After 5 days on YEPD at 25°C colonies are butyrous, light cream-colored and circular. The surface is smooth usually flat or raised and opaque. Cells are globose, ovoidal or elongate and are usually isolated or in small groups.  
Name of Depositor R Del Carratore
Special Collection ATCC
Chain of Custody ATCC <-- R Del Carratore
Isolation
Not available
Cross References

Nucleotide (GenBank) : JQ070152 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JQ070126 ITS including 5.8S rRNA gene

References

Del Carratore R, et al. Cytochrome P-450 inducibility by ethanol and 7-ethoxycoumarin O-deethylation in S. cerevisiae. Biochem. Biophys. Res. Commun. 123: 186-193, 1984. PubMed: 6383378

Del Carratore R, et al. Expression of cytochrome P450 in yeast after different chemical treatments. Carcinogenesis 13: 2175-2177, 1992. PubMed: 1423890

Morichetti E, et al. Metabolism of 5-methoxypsoralen by Saccharomyces cerevisiae. Photochem. Photobiol. 54: 689-695, 1991. PubMed: 1798745

Morichetti E, et al. Induction of cytochrome P-450 and catalase activity in Saccharomyces cerevisiae by UV and X-ray irradiation. Possible role for cytochrome P-450 in cell protection against oxidative damage. Yeast 5: 141-148, 1989. PubMed: 2660460

Del Carratore R, et al. Cytochrome P-450 factors determining synthesis in strain D7 Saccharomyces cerevisiae. Mutation Res. 121: 117-123, 1983. PubMed: 6348531

Del Carratore R, et al. Specific inhibitors of the monoxygenase system of Saccharomyces cerevisiae modified the mutagenic effect of 4-nitroquinoline 1-oxide and the deethylation activity of the yeast. Carcinogenesis 7: 1127-1130, 1986. PubMed: 3087645

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation