To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X
Search

Zygosaccharomyces bailii (Lindner) Guilliermond (ATCC® 58445™)

Strain Designations: CBS 680 [CCRC 21525, CLIB 213, DBVPG 6287, IFO 1098, IGC 2470, NCYC 1416, NRRL Y-2227]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Classification Fungi, Ascomycota, Saccharomycotina, Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Zygosaccharomyces
Strain Designations CBS 680 [CCRC 21525, CLIB 213, DBVPG 6287, IFO 1098, IGC 2470, NCYC 1416, NRRL Y-2227]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Spoilage yeast in food and beverage
Genome sequencing strain (INRA - Montpellier Centre, France)
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TTTCCGTAGGTGAACCTGCGGAAGGATCATTATAGAAAATTTCTGATTGACGAGTCTGGAGTAGTTGTGTTCTCTCTGTTTTTTCAAGGCCTGCGCTTAATTGCGCGGTCTAGAGCGGAGGGAGTTAAACATAGTTACTCTGGCTTTCAATTTACACACAGTGGAGTTTCTACTTTTTTTATTCTTCTTTGGGAGGATGGGTTCGTCCCACTCCCAGAGGTAAAAACACAAACAATTTTTTTTTTTTTTTTAATATTACACAGTCAAAAACGAATACTAAAAAAACAAAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCGTGTTTGGTAGTGAGTGATACTCTGTTTTTCATTTGGGTTAACTTGAAATTGCAAGCCTTTTGGGGAACGCGTGTGGGTGAGTTTTAGGCGGAAACGTCTTGCTCTCCTCTTTCCTAACCAAATGTCGTATTAGGTTTTACCGACTCCGACAGACGGGACTAGGAGATTGGGTGAGTGATAGCAATATCGAGCTCTGCCTAATTTTTTTTTTGCGCGCCTTGGGCAAACAATACTCTCAAAGTTTGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGTAGAAGGCGACTCTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTATGGCGAGGATCCCAGTTCTTTGTAGAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCTCGCCTCTCGTGGGTGGGGGAATCTCGCAGTTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCCCTGGGAATGTAGCTCTACCACTTCGTGGCGGACGAACTTATAGTCCAGGGGAATACTGCCAGCTGGGACTGAGGAATGCGACTTTTAGTCAAGGATGCTGGCATAATGGTTATATGCCGC
Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- H Naganishi
Cross References

Nucleotide (GenBank) : JX458098 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX458117 D1/D2 region of 26S rRNA gene

Nucleotide (GenBank) : KC678099 RNA polymerase II largest subunit (RPB1) gene

Nucleotide (GenBank) : KC678068 polymerase II second largest subunit (RPB2) gene

Nucleotide (GenBank) : KC678089 translation elongation factor 1-alpha gene

Nucleotide (GenBank) : KC678083 beta-tubulin gene

Nucleotide (GenBank) : KC678086 cytochrome oxidase subunit 2 (CoxII) gene

Nucleotide (GenBank) : KC678092 mitochondrial small subunit ribosomal RNA gene

Nucleotide (GenBank) : X91083 18S ribosomal RNA

Nucleotide (GenBank) : X84640 rRNA ITS1 spacer region DNA

Nucleotide (GenBank) : X84641 rRNA ITS2 spacer region DNA

Nucleotide (GenBank) : U72161 26S ribosomal RNA gene, partial sequence

References

Suh SO, et al. Proposal of Zygosaccharomyces parabailii sp. nov. and Zygosaccharomyces pseudobailii sp. nov., two new species closely related to Zygosaccharomyces bailii. Int. J. Syst. Evol. Microbiol. 63: 1922-1929, 2013. PubMed: 23524351

Lindner P. Saccharomyces farinosus und Saccharomyces bailii. Zwei neue Hefenarten aus Danziger Jopenbier. Wochenschr. Brau. 11: 153-156, 1894.

James SA, et al. Genetic interrelationship among species of the genus Zygosaccharomyces as revealed by small-subunit rRNA gene sequences. Yeast 10: 871-881, 1994. PubMed: 7985415

James SA, et al. Use of an rRNA internal transcribed spacer region to distinguish phylogenetically closely related species of the genera Zygosaccharomyces and Torulaspora. Int. J. Syst. Bacteriol. 46: 189-194, 1996. PubMed: 8573494

Kurtzman CP, Robnett CJ. Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. Antonie van Leeuwenhoek 73(4): 331-371, 1998. PubMed: 9850420

Galeote V, et al. Genome sequence of the food spoilage yeast Zygosaccharomyces bailii CLIB 213T. Genome Announc 1(4). pii: e00606-13, 2013. PubMed: 23969048

James SA, et al. Molecular evidence for the existence of natural hybrids in the genus Zygosaccharomyces. FEMS Yeast Res. 5: 747-755, 2005. PubMed: 15851103

Kurtzman CP, Robnett CJ. Phylogenetic relationships among yeasts of the 'Saccharomyces complex' determined from multigene sequence analyses. FEMS Yeast Res 3: 417-432, 2003. PubMed: 12748053

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS