To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X

Saccharomyces cerevisiae Meyen ex E.C. Hansen (ATCC® 4126)

Alternate State: Candida robusta Diddens et Lodder  /  Strain Designations: [BI CZAS 321/7, CBS 1200, CCRC 21494, CCY 21-4-26, VTT C-79092]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Saccharomyces anamensis Will et Heinrich
Classification Fungi, Ascomycota, Saccharomycotina, Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomyces
Strain Designations [BI CZAS 321/7, CBS 1200, CCRC 21494, CCY 21-4-26, VTT C-79092]
Alternate State Candida robusta Diddens et Lodder
Application
Produces alcohol
Produces ethyl alcohol ethanol
Transformation host
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes (type strain of Saccharomyces anamensis)
Preceptrol® no
Ploidy polyploid
Comments
Ferments at high temperature
Ethanol inhibition
Ethanol production at different oxygenation levels
Immobilization on porous glass
Continuous fermentation/membrane pervaporation system
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAAATTTAATAATTTTGAAAATGGATTTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGGGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTTCCCAAAGAGAGGTTTCTCTGCGTGCTTGASGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC

Name of Depositor FA McDermott
Chain of Custody
ATCC <-- FA McDermott <-- CBS 1200 <-- P. Redaelli
Isolation
Amylo process yeast
References

Maiorella BL, et al. Feed component inhibition in ethanolic fermentation by Saccharomyces cerevisiae. Biotechnol. Bioeng. 26: 1155-1166, 1984.

Bowman L, Geiger E. Optimization of fermentation conditions for alcohol production. Biotechnol. Bioeng. 26: 1492-1497, 1984.

Hoppe AK, Hansford AS. Ethanol inhibition of continuous anaerobic yeast growth. Biotechnol Lett 4: 39-44, 1982.

Ness F, et al. Identification of yeast strains using the polymerase chain reaction. J. Sci. Food Agric. 62: 89-94, 1993.

Will H. Saccharomyces anamensis, die Hefe des neueren Amyloverfahrens. Centralbl. Bakteriol. Parasitenkd. Infektionskr. II Abt. 39: 26-53, 1913.

De Backer L, Baron G. Effective diffusitivity and tortuosity in a porous glass immobilization matrix. Appl Microbiol Biotechnol 39: 281-284, 1993.

O'Brien DJ, Craig Jr JC. Ethanol production in a continuous fermentation/membrane pervaporation system. Appl Microbiol Biotechnol 44: 699-704, 1996.

Ness F, Aigle M. RTM1: a member of a new family of telomeric repeated genes in yeast. Genetics 140: 945-956, 1995. PubMed: 7672593

Hinfray C, Jouenne T, Junter G. Ethanol production from glucose by free and agar-entrapped batch cultures of Saccharomyces cerevisiae at different oxygenation levels. Biotechnol Lett 16: 1107-1112, 1994.

Bazua CD, Wilke CR. Ethanol effects on the kinetics of a continuous fermentation with Saccharomyces cerevisiae. Biotechnol. Bioeng. Symp. 7: 105-118, 1977. PubMed: 332248

Jones RP, et al. Alcohol fermentation by yeasts -- the effect of environmental and other variables. Process Biochem. 16(3): 42-49, 1981.

Taylor F, et al. Dry-grind process for fuel ethanol by continuous fermentation and stripping. Biotechnol. Prog. 16: 541-547, 2000. PubMed: 10933825

Huang CH, Lee FL, Tai CJ. The beta-tubulin gene as a molecular phylogenetic marker for classification and discrimination of the Saccharomyces sensu stricto complex. Antonie van Leeuwenhoek 95: 135-142, 2009. PubMed: 19112604

type strain of Saccharomyces anamensis

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation