ATCC ATCC Logo 0
  • Quick Order
  • Careers
  • Support

Zygosaccharomyces bailii (Lindner) Guilliermond

8766

An ampoule containing viable cells suspended in cryoprotectant.
Product category
Fungi
Product type
Yeast
Strain designation
[BI CZAS 327, CBS 749, CCY 21-27-1, DBVPG 6380, IFO 0722, IFO 1126, IFO 1137, NCYC 573, NRRL Y-1011]
Type strain
Yes; type strain of Zygosaccharomyces acidifaciens
Isolation source
Domestic wine
Applications
Food production research
Product format
Freeze-dried
Storage conditions
2°C to 8°C
Buy Now
Price: $418.00 EA
Discounts may be available for our fellow nonprofit organizations. Login to see your price.

Generally ships within 1-3 business days

Documentation

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.

Detailed product information

General

Specific applications

Potential strain for fermented food and beverage production; Wine and beer production

Non-conventional yeasts for bioconversion and precision fermentation

Preceptrol
No

Characteristics

Morphology
After 3 days at 25°C growth is butyrous and tannish-white in color. Cells are spheroidal to ellipsoidal, and single or in pairs. 

Handling information

Medium
Temperature
24-26°C
Atmosphere
Aerobic
Handling procedure

For freeze-dry (lyophilized) ampoules:

  1. Open an ampoule according to enclosed instructions.
  2. From a single test tube of sterile distilled water (5 to 6 mL), withdraw approximately 0.5 to 1.0 mL with a sterile pipette and apply directly to the pellet.  Stir to form a suspension.
  3. Aseptically transfer the suspension back into the test tube of sterile distilled water.
  4. Let the test tube sit at room temperature (25°C) undisturbed for at least 2 hours; longer (e.g., overnight) rehydration might increase viability of some fungi.
  5. Mix the suspension well.  Use several drops (or make dilutions if desired) to inoculate recommended solid or liquid medium. Include a control that receives no inoculum.
  6. Incubate the inoculum at the propagation conditions recommended.
  7. Inspect for growth of the inoculum/strain regularly. Viability is typically noticeable after 1-2 days of incubation. However, the time necessary for significant growth will vary from strain to strain.

 

Handling notes
No special notes.

Additional, updated information on this product may be available on the ATCC web site at www.atcc.org.

Quality control specifications

Sequenced data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TTTCCGTAGGTGAACCTGCGGAAGGATCATTATAGAAAATTTCTGATTGACGAGTCTGGAGTAGTTGTGTTCTCTCTGTTTTTTCAAGGCCTGCGCTTAATTGCGCGGTCTAGAGCGGAGGGAGTTAAACATAGTTACTCTGGCTTTCAATTTACACACAGTGGAGTTTCTACTTTTTTTATTCTTCTTTGGGAGGATGGGTTCGTCCCACTCCCAGAGGTAAAAACACAAACAATTTTTTTTTTTTTTTAATATTACACAGTCAAAAACGAATACTAAAAAACAAAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCGTGTTTGGTAGTGAGTGATACTCTGTTTTTCATTTGGGTTAACTTGAAATTGCAAGCCTTTTGGGGAACGCGTGTGGGTGAGTTTTAGGCGGAAACGTCTTGCTCTCCTCTTTCCTAACCAAATGTCGTATTAGGTTTTACCGACTCCGACAGACGGGACTAGGAGATTGGGTGAGTGATAGCAATATCGAGCTCTGCCTAATTTTTTTTTTGCGCGCCTTGGGCAAACAATACTCTCAAAGTTTGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGTAGAAGGCGACTCTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTATGGCGAGGATCCCAGTTCTTTGTAGAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCTCGCCTCTCGTGGGTGGGGGAATCTCGCAGTTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCCCTGGGAATGTAGCTCTACCACTTCGTGGCGGACGAACTTATAGTCCAGGGGAATACTGCCAGCTGGGACTGAGGAATGCGACTTTTAGTCAAGGATGCTGGCATAATGGTTATATGCCGC

History

Deposited as
Zygosaccharomyces acidifaciens Nickerson, teleomorph
Synonyms
Zygosaccharomyces manchuricus Saito, teleomorph; Zygosaccharomyces naniwaensis Otani, teleomorph; Zygosaccharomyces acidifaciens Nickerson, teleomorph; Saccharomyces bailii Lindner var. bailii, teleomorph; Saccharom~
Depositors
WJ Nickerson
Type of isolate
Food & Beverage
Cross references
GenBank JX458100 ITS including 5.8S rRNA gene
GenBank JX458119 D1/D2 region of 26S rRNA gene
GenBank KC678095 RNA polymerase II largest subunit (RPB1) gene
GenBank KC678069 polymerase II second largest subunit (RPB2) gene

Legal disclaimers

Intended use
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.
Warranty

The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Permits & Restrictions

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

Frequently Asked Questions

References

Curated Citations

Suh SO, et al. Proposal of Zygosaccharomyces parabailii sp. nov. and Zygosaccharomyces pseudobailii sp. nov., two new species closely related to Zygosaccharomyces bailii. Int. J. Syst. Evol. Microbiol. 63: 1922-1929, 2013. PubMed: 23524351

Nickerson WJ. Zygosaccharomyces acidifaciens: a new acetifying yeast. Mycologia 35: 66-78, 1943.

Need assistance with this product? Contact our Technical Support team.

Telephone

US and Puerto Rico
800-638-6597

Outside the US
+1-703-365-2700

Hours of Operation

Monday-Friday
9:00am - 5:00pm
US Eastern Time