Quantitative Synthetic SARS-CoV-2 RNA: Spike 5'


ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day-to-day test variation, and lot-to-lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine viral load. Preparation includes a fragment from the 5’ Glycoprotein (Spike) region.
Product category
Product type
Nucleic acid
Molecular standard
Severe acute respiratory syndrome-related coronavirus 2
Assay development
Infectious disease research
Respiratory disease research
Molecular biology
Specification range
≥ 1 x 105 to 1 x 106 copies/μL
100 μL
Product format
Shipping information
Shipped in Biomatrica RNAstable
Storage conditions
-70°C or colder
Buy Now
Price: $541.00 ea
Discounts are available for our fellow nonprofit organizations.

Generally ships within 1-3 business days


Haven't found what you need?

Customize solution

We tailor our materials for your specific application.

Get application-specific materials

Biosafety Icon BSL 1

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

Required Products

These products are vital for the proper use of this item and have been confirmed as effective in supporting functionality. If you use alternative products, the quality and effectiveness of the item may be affected.

Molecular Grade Water


Price: $40.00 ea

Detailed product information


Specific applications
ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day-to-day test variation, and lot-to-lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine viral load.


Genetic target
Preparation includes a fragment from the 5’ Glycoprotein (Spike) region

Manufactured under ISO 13485 guidance

The following primers and probe can be used with this nucleic acid preparation.
Forward primer (5’ to 3’): ATCAACTTACTCCTACTTGGCG
Reverse primer (5’ to 3’): ACCAATGGGTATGTCACACTC

Handling information

Handling procedure
  1. Thaw the vial at room temperature and immediately place on ice. Avoid exposing the synthetic RNA to repeated freeze-thaw cycles as it may result in degradation of the RNA and variation in copy number.
  2. Gently mix the sample to ensure an even distribution of material.
  3. Briefly centrifuge the tube before opening to ensure all liquid is at the bottom.
Handling notes
RNA is easily degraded. Take extra precautions against contamination by using new gloves and clean lab coats when working with RNA. Use only RNase-free lab materials when handling this product. Vortexing can damage the synthetic RNA. Gentle pipetting is highly recommended. Aliquoting is highly recommended to avoid multiple freeze-thaws, which can damage the synthetic RNA.



Legal disclaimers

Intended use
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.
The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent.
Biomatrica Logo

The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.


This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at

Permits & Restrictions

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.



Frequently Asked Questions

Need assistance with this product? Contact our Technical Support team.



US and Puerto Rico

Outside the US

Hours of Operation

9:30am - 5:30pm
US Eastern Time

Need help with something else? Contact us.