ATCC ATCC Logo 0

Quantitative Synthetic DNA from Hepatitis A virus

VR-3257SD

ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day-to-day test variation, and lot-to-lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine viral load. Preparation includes genomic segments from the 5’ untranslated region, viral capsid proteins (VP1- 4), self-cleaving peptide 2A, proteinase 3C, and 3D RNA polymerase.
Product category
Viruses
Product type
Nucleic acid
Molecular standard
Organism
Hepatitis A virus
Applications
Assay development
Enteric disease research
Infectious disease research
Next-generation sequencing
Specification range
≥ 1 x 105 to 1 x 106 copies/μL
Volume
100 μL
Product format
Frozen
Shipping information
Shipped in Biomatrica DNAstable
Storage conditions
-20°C or colder
Buy Now
Price: $541.00 EA
Discounts are available for our fellow nonprofit organizations.

Generally ships within 1-3 business days

Documentation

Haven't found what you need?

Customize solution

We tailor our materials for your specific application.

Get application-specific materials

Biosafety Icon BSL 1

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

Required Products

These products are vital for the proper use of this item and have been confirmed as effective in supporting functionality. If you use alternative products, the quality and effectiveness of the item may be affected.

Molecular Grade Water

60-2450

Price: $40.00 ea

Detailed product information

General

Specific applications
ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day-to-day test variation, and lot-to-lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine viral load.

Characteristics

Genetic target
Preparation includes genomic segments from the 5’ untranslated region, viral capsid proteins (VP1- 4), self-cleaving peptide 2A, proteinase 3C, and 3D RNA polymerase.
Comments
Manufactured under ISO 13485 guidance
br />

The following primers and probe can be used with this nucleic acid preparation

RefCosta-Mattioli M, et al. Quantification and duration of viraemia during hepatitis A infection as determined by real-time RT-PCR. J Viral Hepat 9(2): 101-106, 2002. PubMed: 11876791:
Forward primer: TTTCCGGAGCCCCTCTTG
Reverse primer: AAAGGGAAATTTAGCCTATAGCC
Probe: FAM-ACTTGATACCTCACCGCCGTTTGCCT-TAMRA

Handling information

Handling procedure
  1. Thaw the vial at room temperature and immediately place on ice. Avoid exposing the synthetic DNA to repeated freeze-thaw cycles as it may result in degradation of the DNA and variation in copy number.
  2. Gently mix the sample to ensure an even distribution of material.
  3. Briefly centrifuge the tube before opening to ensure all liquid is at the bottom.
Handling notes
Aliquoting is highly recommended to avoid multiple freeze-thaws, which can damage the synthetic DNA.

Quality control specifications

Quality accreditation
Manufactured under ISO 13485 guidance

History

Depositors
ATCC
Cross references
GenBank K02990.1 Human hepatitis A virus, complete genome

Legal disclaimers

Intended use
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.
The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent.
Biomatrica Logo
Warranty

The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Permits & Restrictions

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

References

Curated Citations

Coudray-Meunier C, et al. Discrimination of infectious hepatitis A virus and rotavirus by combining dyes and surfactants with RT-qPCR. BMC Microbiol 13: 216, 2013. PubMed: 24083486

Coudray-Meunier C, et al. Hepatitis A virus subgenotyping based on RT-qPCR assays. BMC Microbiol 14: 296, 2014. PubMed: 25420941

Sánchez G, et al. Molecular characterization of hepatitis a virus isolates from a transcontinental shellfish-borne outbreak. J Clin Microbiol 41(11): 4148-4155, 2002. PubMed: 12409389

Prado T, Gaspar AM, Miagostovich MP. Detection of enteric viruses in activated sludge by feasible concentration methods. Braz J Microbiol 45(1): 343-349, 2014. PubMed: 24948954

Hussain Z, et al. Virological course of hepatitis A virus as determined by real time RT-PCR: Correlation with biochemical, immunological and genotypic profiles. World J Gastroenterol 12(29): 4683-4688, 2006. PubMed: 16937439

View All Curated Citations for this Product

Frequently Asked Questions

Need assistance with this product? Contact our Technical Support team.

Telephone

Telephone

US and Puerto Rico
800-638-6597

Outside the US
+1-703-365-2700
hours

Hours of Operation

Monday-Friday
9:30am - 5:30pm
US Eastern Time