pCarrier 8 (integ)
SB-1005 ™
pCarrier 8 (integ) is an integration vector for targeting the yeast Saccharomyces cerevisiae HO locus. Two 45 bp unique nucleotide sequences (UNS-1: GGTTTACCGAGCTCTTATTGGTTTTCAAACTTCATTGACTGTGCC and UNS-X: GGTTAGGCGACTGTTATAACTTACCTCTGTAATACTAGTGATACC) in the vector allow for the assembly of multiple transcription units. Two HO fragments (~480 bp) flanking these sequences mediate HO locus integration via homologous recombination (detail information is described in the ATCC® Synthetic Biology Solutions User Guide).
 
                     
                         Powered by Bioz
 Powered by Bioz
				 
                         
                         
                    