Phanerochaete chrysosporium Burdsall

24725 ^™

An ampoule containing viable cells (may include spores and mycelia) suspended in cryoprotectant.

Product category: Fungi
Strain designation: VKM F-1767 [CBS 481.73, CCRC 36200, IMI 174727, NRRL 6361, QM 9998]
Type strain: Yes; type strain of Sporotrichum pulverulentum
Genome sequenced strain: Yes
Isolation source: Fruit and petiole of grape, Vitis vinifera
Geographical isolation: Kazakhstan; Almaty Province
Applications: Bioremediation

Biofuel production

Quality control

Agricultural research
Product format: Freeze-dried
Storage conditions: 2°C to 8°C

See Additional Product Information

Price: $418.00 EA

Discounts may be available for our fellow nonprofit organizations. Login to see your price.

Limited inventory

Documentation

Product sheet

BSL 1

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.

General

Specific applications

Bacterial resistance testing adhesives

Degrades 1,1-dichloro-2,2-bis(4-chlorophenyl)ethene DDE

Degrades 2,4,5-trichlorophenol

Degrades 2,4,5-trichlorophenoxyacetic acid 2,4,5-T

Degrades 2,4,6-trichlorophenol

Degrades 2,4,6-trinitrotoluene TNT

Degrades 3,4-dichloroaniline

Degrades Congo red Congo Red

Degrades DDT

Degrades acid yellow 9

Degrades aldrin

Degrades amaranth

Degrades atrazine

Degrades azo dyes

Degrades azure B Azure B

Degrades benzene

Degrades benzo(a)pyrene

Degrades biphenyl

Degrades chlordane

Degrades creosote

Degrades cyclonite RDX, cyclotrimethylene trinitramine

Degrades dieldrin

Degrades ethylbenzene

Degrades fluorene

Degrades heptachlor

Degrades humic acid

Degrades lignin

Degrades lindane

Degrades mirex

Degrades o-chlorophenol

Degrades olive-mill wastewater

Degrades orange G Orange G

Degrades orange II Orange II

Degrades pentachlorophenol

Degrades phenanthrene

Degrades polychlorinated biphenyls

Degrades polycyclic aromatic hydrocarbons

Degrades rose Bengal

Degrades sulfanilic acid

Degrades toluene

Degrades tropaeolin O

Degrades veratryl alcohol

Degrades xylene

Fungus resistance testing adhesives

Produces N-(chlorophenol)-succinimides

Produces NAD(P)H menadione oxidoreductase 1, dioxin-inducible NADH: quinone oxidoreductase, NADH dehydrogenase (quinone)

Produces aryl-alcohol dehydrogenase

Produces cellobiose dehydrogenase (quinone) cellobiose:quinone oxidoreductase

Produces coal-solubilizing agent

Produces glyoxal oxidase

Produces lignin peroxidase diarylpropane oxygenase

Produces manganese peroxidase

Produces peroxidase

Produces xylan endo-1,3-beta-xylosidase xylan hydrolase, xylanase

Degrades diuron

Potential bioremediation agent: organochlorine pesticide, lignin, organopollutants

Potential biofuel production agent: lignocellulosic ethanol, biodiesel

Recommended as a test microorganism for ASTM D4300: Standard Test Methods for Ability of Adhesive Films to Support or Resist the Growth of Fungi

Potential plant growth promoting strain; Biofertilizer

Preceptrol

Characteristics

Comments: Vitis vinifera

UV- and benomyl-resistant

Degrades pine and straw alkali lignins

Degrades pulp and paper-mill wastewater

Degrades fluorene in soil

Degrades veratryl alcohol and its methyl ether by lignin peroxidase

Decolorizes textile-industry wastewater

Parental strain of RP-78 (genome sequencing strain by the Joint Genome Institute at the Department of Energy, USA)

This strain is also known as BKM-F-1767.
Technical information: ATCC Technical Services does not have technical information on patent deposits that are not produced or characterized by ATCC. Additional information can be found in the corresponding patent available from the patent holder or with the U.S. and/or international patent office.

Handling information

Medium

ATCC Medium 200: YM agar or YM broth

ATCC Medium 324: Malt extract agar

ATCC Medium 336: Potato dextrose agar (PDA)

Temperature

25-30°C

Atmosphere

Aerobic

Handling procedure

For freeze-dry (lyophilized) ampoules:

Open an ampoule according to enclosed instructions.
From a single test tube of sterile distilled water (5 to 6 mL), withdraw approximately 0.5 to 1.0 mL with a sterile pipette and apply directly to the pellet. Stir to form a suspension.
Aseptically transfer the suspension back into the test tube of sterile distilled water.
Let the test tube sit at room temperature (25°C) undisturbed for at least 2 hours; longer (e.g., overnight) rehydration might increase viability of some fungi.
Mix the suspension well. Use several drops (or make dilutions if desired) to inoculate recommended solid or liquid medium. Include a control that receives no inoculum.
Incubate the inoculum at the propagation conditions recommended.
Inspect for growth of the inoculum/strain regularly. The sign of viability is noticeable typically after 3 to 5 days of incubation. However, the time necessary for significant growth will vary from strain to strain.

Handling notes

Type strain of Sporotrichum pulverulentum.

Additional, updated information on this product may be available on the ATCC^® web site at www.atcc.org.

Quality control specifications

Sequenced data: 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
ACCTGCGGAAGGATCATTAACGAGTAACTGAACAGGTTGTAGCTGGCCTCTCGGGGCATGTGCACGCCTGGCTCATCCACTCTTCAACCTCTGTGCACTTGTTGTAGGTCGGTAGAAGAGCGAGCATCCTCTGATGCTTTGCTTGGAAGCCTTCCTATGTTTTACTACAAACGCTTCAGTTTAAGAATGTCTACCTGCGTACAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTATCCTCAACCTTCATAACTTTTTGTTATCGAAGGCTTGGACTTGGAGGTTGTGCTGGCTTCTAGTCGAGTCGGCTCCTCTTAAATGTATTAGCGTGAGTGTAACGGATCGCTTCGGTGTGATAATTATCTGCGCCGTGGTCGTGAAGTAACATAAGCTTGCGCTTCTAACCGTCCTTCAGTTGGACAACTTACTTTGACATCTGACCTCAAATCAGGTAGGA

History

Deposited as: Sporotrichum pulverulentum Novobranova
Depositors: LA Beljakova
Chain of custody: ATCC <-- LA Beljakova <-- TI Novobranova
Patent depository: This material was deposited with the ATCC Patent Depository to fulfill U.S. or international patent requirements. This material may not have been produced or characterized by ATCC. As an International Depository Authority (IDA) for patent deposits, ATCC is required to complete viability testing only at time of initial deposit of patent material. Patent deposits are made available on behalf of the Depositor when the pertinent U.S. or international patent is issued, but material may not be used to infringe the patent claims.
Type of isolate: Food & Beverage; Plant
Cross references: GenBank KU729061 ITS including 5.8S rRNA gene

GenBank L18991 glyoxal oxidase cDNA

GenBank Z11729 cellobiohydrolase CBH1-6 gene, 3' end

GenBank X15599 Phanerochaete chrysosporium LIP2 gene for lignin peroxidase.

GenBank M18794 Phanerochaete chrysosporium ligninase precursor, mRNA, complete

GenBank M21913 Phanerochaete chrysosporium peroxidase isozyme H8 mRNA, partial

GenBank X51590 Phanerochaete chrysosporium GLG3 (LIP) gene for lignin peroxidase

GenBank X12698 Phanerochaete chrysosporium mRNA for ligninase (rLDM(TM)6) apoprotein

GenBank AADS01000000 Phanerochaete chrysosporium RP-78, whole genome shotgun sequencing project.

Legal disclaimers

Intended use

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.

Warranty

The product is provided 'AS IS' and the viability of ATCC^® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid. Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Disclosures

This material is cited in a US and/or international patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Depositor of the party to which the material was furnished.

Permits & Restrictions

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

References

Curated Citations

Paszczynski A, et al. Enzymatic activities of an extracellular, manganese-dependent peroxidase from Phanerochaete chrysosporium. FEMS Microbiol. Lett. 29: 37-41, 1985.

Leisola MS, et al. Homology among multiple extracellular peroxidases from Phanerochaete chrysosporium. J. Biol. Chem. 262: 419-424, 1987. PubMed: 2432065

Troller J, et al. Crystallization of a lignin peroxidase from the white-rot fungus Phanerochaete chrysosporium. Bio-Technology 6: 571-573, 1988.

Kersten PJ, Kirk TK. Involvement of a new enzyme, glyoxal oxidase, in extracellular H2O2 production by Phanerochaete chrysosporium. J. Bacteriol. 169: 2195-2201, 1987. PubMed: 3553159

George EJ, Newfeld RD. Degradation of fluorene in soil by fungus Phanerochaete chrysosporium. Biotechnol. Bioeng. 33: 1306-1310, 1989.

View All Curated Citations for this Product

Need assistance with this product? Contact our Technical Support team.

Email

Send us a message

Telephone

US and Puerto Rico

800-638-6597

Outside the US

+1-703-365-2700

Hours of Operation

Monday-Friday

9:00am - 5:00pm
US Eastern Time