• Quick Order

pSRE-Luciferase plasmid in Escherichia coli


Contains 3 tandem copies of repeats 2 and 3, the sterol response element, of the human LDL receptor promoter  (nt -68 to -37).  The sequence of the repeat is AAAATCACCCCACTGCAAACTCCTCCCCCTGC
There are additional restriction sites on the 3' end of the insert including EcoRI and BamHI. The sequence of the entire 191 bp insert is (SRE insert sequence is in caps):
Molecular biology
Product format
Shipping information
Escherichia coli containing the plasmid in glycerol stock
Storage conditions
-80°C or colder
Buy Now
Price: $567.00 EA
Discounts are available for our fellow nonprofit organizations.

Generally ships within 1-3 business days


Haven't found what you need?

Customize solution

We tailor our materials for your specific application.

Get application-specific materials

Biosafety Icon BSL 1

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

Detailed product information


Mycoplasma contamination
Not detected

Vector information

Construct size (kb)
Vector name
Vector information
PolyA signal: SV40 (after the luciferase reporter)
Insert detection
SmaI; BglII
SmaI KpnI SacI MluI NheI XhoI Bgl II HindIII
Reporter group

Insert information

Insert size (kb)
Insert information
Insert: 3 tandem copies of repeats 2 and 3 of the human LDL Receptor promoter, also known as the sterol response element (SRE)

Handling information

Escherichia coli DH5α
Handling procedure
Transfer  a loopful to a test tube containing 5 mL LB+50 µg/mL of ampicillin broth. A loopful of culture can also be streaked on an LB + amp agar plate. Incubate cultures at 37°C. Isolate DNA using standard plasmid preparation procedures.


J Goldstein

Legal disclaimers

Intended use
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.

The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.


This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at

Permits & Restrictions

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.



Frequently Asked Questions

Need assistance with this product? Contact our Technical Support team.



US and Puerto Rico


Outside the US


Hours of Operation

9:30am - 5:30pm
US Eastern Time