Aspergillus fumigatus Fresenius (ATCC® MYA-4609)

Strain Designations: CBS 101355 [AF 293]  /  Product Format: frozen

Strain Designations CBS 101355 [AF 293]
Application
Emerging infectious disease research
Respiratory research
Opportunistic pathogen research
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (The Institute for Genomic Research (TIGR), J. Craig Venter Institute, USA).
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTTCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGTGCAGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGACGGGGTGTCTGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCTCGGAATGTATCACCTCTCGGGGTGTCTTATAGCCGAGGGTGCAATGCGGCCTGCCTGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCGTAATGGTCGTAAATGAC


beta-tubulin

AAGGTGTGTGGATGAAACTCTTGATTTATACTATTTCGGCAACATCTCACGATCTGACTCGCTACTAGGCCAACGGTGACAAATATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCTGGTACCATGGACGCTGTCCGTGCCGGTCCCTTCGGCGAGCTATTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTACACTGAG

Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS <-- JP Latgé
Cross References

Nucleotide (GenBank) : GU291268 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KC146385 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : AAHF00000000 Aspergillus fumigatus Af293, whole genome shotgun sequencing project

Nucleotide (GenBank) : KU897003 beta-tubulin gene

References

Balajee SA, et al. Mistaken identity: Neosartorya pseudofischeri and its anamorph masquerading as Aspergillus fumigatus. J. Clin. Microbiol. 43: 5996-5999, 2005. PubMed: 16333088

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262

Arnaud MB, et al. The Aspergillus Genome Database (AspGD): recent developments in comprehensive multispecies curation, comparative genomics and community resources. Nucleic Acids Res 40:D653-D659, 2012. PubMed: 22080559

Joardar V, et al. Sequencing of mitochondrial genomes of nine Aspergillus and Penicillium species identifies mobile introns and accessory genes as main sources of genome size variability. BMC Genomics 13: 698, 2012. PubMed: 23234273

Nierman WC, et al. Genomic sequence of the pathogenic and allergenic filamentous fungus Aspergillus fumigatus. Nature 438: 1151-1156, 2005. PubMed: 16372009