Cryptococcus neoformans var. grubii Franzot et al. (ATCC® 208821)

Strain Designations: H99 [H99JP, NYSD 1649]  /  Product Format: frozen

Deposited As Cryptococcus neoformans (Sanfelice) Vuillemin
Strain Designations H99 [H99JP, NYSD 1649]
Application
Biomedical Research and Development Material
Emerging infectious disease research
Negative control in differential gene expression studies
Produces laccase
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Antigenic Properties Serotype A
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type Mating type: alpha (Peter R Williamson, personal communication)
Comments
Multigene phylogeny and phenotypic characterization. 

Facultative intracellular pathogen 

Genome sequencing strain (Broad Institute, USA)

Morphology After 8 days on YM agar at 30°C, colony is cream-colored, smooth, mucoid. Cells globose or subglobose, single or with bud, pseudohyphae not observed.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATATTGGACTTCGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCTTATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene.

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCCGGGCGTCCGAGTTGTAATCTACAGAAACGTTTTCCGTGCTGGACCGTGTCTAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGATCACCAGTGCTCTGTGATACGTTTTCTACGAGTCGCGTTACTTGGGAGTGTAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGTGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGGTTCAGCCAGTTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGGATAAGGGCTGGGGGAATGTAGCACTCTTCGGAGTGTGTTATAGCCTCCTGTCGCATACACTGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACAAAATGGCTTTAAACGAC

Morphology After 8 days on YM agar at 30°C, colony is cream-colored, smooth, mucoid. Cells globose or subglobose, single or with bud, pseudohyphae not observed.
Name of Depositor PR Williamson
Special Collection NCRR Contract
Chain of Custody
ATCC <-- PR Williamson <-- JR Perfect
Isolation
Patient with Hodgkin's disease, New York
Cross References

Nucleotide (GenBank) : KU729082 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : AF254790 Filobasidiella neoformans var. neoformans vacuolar (H+)-ATPase

Nucleotide (GenBank) : AF098972 phosphatidylinositol 3-kinase TOR1 (TOR1), complete coding sequence

Nucleotide (GenBank) : AF097888 macrolide-binding protein FKBP12 (FRR1) gene, complete coding sequence

Nucleotide (GenBank) : AF097889 macrolide-binding protein FKBP12 (FRR1) mRNA, complete coding sequence

Nucleotide (GenBank) : AACO02000000 Cryptococcus neoformans var. grubii H99, whole genome shotgun sequencing project.

References

Williamson PR, et al. Melanin biosynthesis in Cryptococcus neoformans. J. Bacteriol. 180: 1570-1572, 1998. PubMed: 9515929

Feldmesser M, et al. Cryptococcus neoformans is a facultative intracellular pathogen in murine pulmonary infection. Infect. Immun. 68: 4225-4237, 2000. PubMed: 10858240

del Poeta M, et al. Cryptococcus neoformans differential gene expression detected in vitro and in vivo with green fluorescent protein. Infect. Immun. 67: 1812-1820, 1999. PubMed: 10085022

Franzot SP, et al. Cryptococcus neoformans var. grubii: separate varietal status for Cryptococcus neoformans serotype A isolates. J. Clin. Microbiol. 37: 838-840, 1999. PubMed: 9986871

Cruz MC, et al. Rapamycin antifungal action is mediated via conserved complexes with FKBP12 and TOR kinase homologs in Cryptococcus neoformans. Mol. Cell. Biol. 19: 4101-4112, 1999. PubMed: 10330150

Heitman J, et al. The Cryptococcus neoformans genome sequencing project. Mycopathologia 148: 1-7, 1999.

Peter R Williamson, personal communication

Findley K, et al. Phylogeny and phenotypic characterization of pathogenic Cryptococcus species and closely related saprobic taxa in the Tremellales. Eukaryot Cell 8(3): 353-361, 2009. PubMed: 19151324

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262

Ding C, et al. The copper regulon of the human fungal pathogen Cryptococcus neoformans H99. Mol. Microbiol. 81: 1560-1576, 2011. PubMed: 21819456

Meyer W. et al. Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii. Med. Mycol. 47(6):561-570, 2009. PubMed: 19462334

Urai M, et al. Evasion of innate immune responses by the highly virulent Cryptococcus gattii by altering capsule glucuronoxylomannan structure. Front Cell Infect Microbiol 5: 101. doi: 10.3389/fcimb.2015.00101. PubMed: 26779451

Sorrell TC, et al. Cryptococcal transmigration across a model brain blood-barrier: evidence of the Trojan horse mechanism and differences between Cryptococcus neoformans var. grubii strain H99 and Cryptococcus gattii strain R265. Microbes Infect 18: 57-67, 2016. PubMed: 26369713

Movahed E, et al. Genome-wide transcription study of Cryptococcus neoformans H99 clinical strain versus environmental strains. PLoS One 10: e0137457, 2015. PubMed: 26360021

Chang YC, et al. Differences between Cryptococcus neoformans and Cryptococcus gattii in the molecular mechanisms governing utilization of D-amino acids as the sole nitrogen source. PLoS One 10: e0131865, 2015. PubMed: 26132227

Janbon G, et al. Analysis of the genome and transcriptome of Cryptococcus neoformans var. grubii reveals complex RNA expression and microevolution leading to virulence attenuation. PLoS Genet 10: e1004261, 2014. PubMed: 24743168

Peter R Williamson, personal communication