Saccharomyces cerevisiae Meyen ex E.C. Hansen (ATCC® 208352)

Alternate State: Candida robusta Diddens et Lodder  /  Strain Designations: W303-1a  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Saccharomyces cerevisiae Hansen
Classification Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomycetaceae, Saccharomyces, cerevisiae
Strain Designations W303-1a
Alternate State Candida robusta Diddens et Lodder
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Genotype MATa ade2-1 ura3-1 his3-11 trp1-1 leu2-3 leu2-112 can1-100
Preceptrol® no
Mating Type a
Ploidy haploid
Comments
Replication, recombination, repair: topoisomerase (CM1)
Morphology

After 4 days at 25°C growth is butyrous and light cream colored, cells are globose, ovoidal or elongate, (3.0 to 8.0) x (5.0 to 10.0) µm, isolated or in small groups.  Sediment is present after one month.

Medium ATCC® Medium 1069: YPAD medium
Growth Conditions Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

   TCCGCTTATTGATATGCTTAAGTTCAGCGGGTACTCCTACCTGATTTGAGGTCAACTTTAAGAACATTGTTCGCCTAGACGCTCTCTTCTTATCGATAACGTTCCAATACGCTCAGTATAAAAAAGATTAGCCGCAGTTGGTAAAACCTAAAACGACCGTACTTGCATTATACCTCAAGCACGCAGAGAAACCTCTCTTTGGAAAAAAAACATCCAATGAAAAGGCCAGCAATTTCAAGTTAACTCCAAAAGTATCACTCACTACCAAACAGAATGTTTGAGAAGGAAATGACGCTCAAACAGGCATGCCCCCTGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACTTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTTAATATTTTAAAATTTCCAGTTACGAAAATTCTTGTTTTTGACAAAAATTTAATGAATAGTAAAATTGTTTGTGTTTGTTACCTCTGGGCCCCGATTGCTCGAATGCCCAAAGAAAAAGTTGCAAAGATATGAAAACTCCACAGTGTGTTGTATTGAAACGGTTTTAATTGTCCTATAACAAAAGCAAGAAATCTCTCACCGTTTGGAATAGCAAGAAAGAAACTTACAAGCCTAGCAAGACCGCGCACTTAAGCGCAGGCCCGGCTGGACTCTCCATCTCTTGTCTTCTTGCCCAGTAAAAGCTCTCATGCTCTGCCAAAACAAAAAAATCCATTTTCAAAATTATTAAATTTCTTTAATGATCCTTCCGCAGGTTCACCTAC

Morphology

After 4 days at 25°C growth is butyrous and light cream colored, cells are globose, ovoidal or elongate, (3.0 to 8.0) x (5.0 to 10.0) µm, isolated or in small groups.  Sediment is present after one month.

Name of Depositor YGSC
Special Collection Yeast Genetic Stock Center
Chain of Custody
ATCC <-- YGSC <-- R. Sternglanz
References

Isogenic with RS190 (ATCC 208354).

Petrezselyovaa S, Zahradkaa J, Sychrova H. Saccharomyces cerevisiae BY4741 and W303-1A laboratory strains differ in salt tolerance. Fungal Biol. 114: 144-150, 2010.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation