Trichosporon dermatis Sugita et al. (ATCC® 204094)

Strain Designations: Vitek 303483 [API 7704022]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Trichosporon mucoides Gueho et Smith
Strain Designations Vitek 303483 [API 7704022]
Application
Quality control strain
Quality control of VITEK® 2 ID-YST card
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments The strain was re-identified as Trichosporon dermatis, a close sister of T. mucoides, based on the multigene sequence comparison.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTGCTCTTTGAGCGTTAAACTATATCCATCTACACCTGTGAACTGTTGATTGACTTCGGTCAATTACTTTTACAAACATTGTGTAATGAACGTCATGTTATTATAACAAAAATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTATCATGAAATCTCAACCATTAGGGTTTCTTAATGGCTTGGATTTGGGCGCTGCCACTTGCCTGGCTCGCCTTAAAAGAGTTAGCGTATTAACTTGTCGATCTGGCGTAATAAGTTTCGCTGGTGTAGACTTGAGAAGTGCGCTTCTAATCGTCTTCGGACAATTCTTGAACTCTGGTCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACTAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAAAGCTCAAATTTGTAATCTGGCTGTCTTCGATAGTCCGAGTTGTAATCTATAGACGTGTTTTCCGTGCTGGACCGTATCTAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGACAATCCCGTGCTTGATACGACCACCAGTGCTCTGTGATACACGCTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTCTTTGGATTCAGCTAGTTCTTCTAGTCTACTTCCATTGAACGGGTCAACATCAGTTTTGTCCGGTGGATAAAGATAGTAGGAATGTAGCTCCCCCGGGAGTGTTATAGACTATTATTGCATACACTGGGTGAGACTGAGGACTGCAGCTCGCCTTTTGGCCGGTCTTCGGACACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGAC


26S-5S ribosomal RNA intergenic spacer (IGS)

ATAGAACGGAGTGCTGTAAGCAGTAGAGTAGCCTTGTTGCTACGATCTGCTGAGGCTCAGCTCTTGTTCTACAGATTTGTGCTTTAGCACTCTCTCCGGTTGCACTAGAGTGGGGCAGTGTACTGTACACACTCTCGAGCCATCGCAGACAGTGACTTGATGCATCAGACCCATGGGTTGTAGCGTCCAAGTTGGTAAGATATGGCCTAGGCTGGACTCGGGTTGAATTCTTGGTAGTATGGCCACCGAGTGTGGCACTGCCTCAGACTTGAACTTTAATAGCCCAATATATTAGCCGGCCGGCTGTATACTACGGCCAAAGTCTTAGTAGCTAGTTAACGGTAGTTTGGAGTGAAGTGCAGCACTTGATTGTGCTGCATTGCAAGCTGCCGGCCTGGCAGCCGTGAGGTTTATAAGCCATTAAACTGTATACTAGTATCTACGGCCATAGGACTGAGAAAATACCGCATCCCGT

Name of Depositor bioMerieux Vitek, Inc.
Special Collection NCRR Contract
Chain of Custody
ATCC <-- bioMerieux Vitek, Inc. <-- API 7704022
Cross References

Nucleotide (GenBank) : KM821113 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KM821092 D1/D2 region of 26S rRNA gene

Nucleotide (GenBank) : KM821102 26S-5S ribosomal RNA intergenic spacer (IGS)

Nucleotide (GenBank) : GU256762 ITS including 5.8S rRNA gene

References

VITEK 2 YST Comprehensive QC Set. bioMerieux.

Suh SO, et al. Characterization of medically important yeast Trichosporon mucoides and its close sister Trichosporon dermatis by traditional and advanced technologies. J. Med. Microbiol. 64: 1135–1143, 2015. PubMed: 26296931

Melhem MS, et al. Use of the VITEK 2 system to identify and test the antifungal susceptibility of clinically relevant yeast species. Braz J Microbiol 44: 1257-1266, 2014. PubMed: 24688520

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation