Schizosaccharomyces pombe Lindner (ATCC® 201401)

Strain Designations: FY118  /  Product Format: frozen

Strain Designations FY118
Application
Transformation host
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Genotype h90 ura4-D18 leu1-32 ade6-M216
Preceptrol® no
Mating Type h90
Ploidy haploid
Medium ATCC® Medium 2064: YES MEDIUM
Growth Conditions
Temperature: 25°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 26S ribosomal RNA gene

CATATCAATAAGCGCAGGAAAAGAAAATAACCATGATTCCCTCAGTAACGGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCTGGCAACATTTCTTTTGTTGTCCGAGTTGTAATTTCAAGAAGCTGCTTTGAGTGTAGACGATCGGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAACCCCGTCTTTGGTCGATTGGATATGCCATATAAAGCGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAATAGTACGTGAAATTGCTGAAAGGGAAGCATTGGAAATCAGTCTTACCTGGGTGAGATCAGTAGTCTCTTCGCGAGACTATGCACTCTGAACCTGTGGTAGGTCAGCATCAGTTTTCGGGGGCGGAAAAAGAATAAGGGAAGGTGGCTTTCCGGGTTCTGCCTGGGGAGTGTTTATAGCCCTTGTTGTAATACGTCCACTGGGGACTGAGGACTGCGGCTTCGTGCCAAGGATGCTGACATAATGGTTTTCAATGG

Name of Depositor SL Forsburg
Special Collection NCRR Contract
References

Forsburg SL, Nurse P. Analysis of the Schizosaccharomyces pombe cyclin puc1: evidence for a role in cell cycle exit. J. Cell Sci. 107: 601-613, 1994. PubMed: 8006074