Talaromyces marneffei (Segretain et al.) Samson et al. (ATCC® 18224)

Strain Designations: QM 7333 [CBS 334.59, IMI 68794, LSHB BB361]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Penicillium marneffei Segretain et al.
Strain Designations QM 7333 [CBS 334.59, IMI 68794, LSHB BB361]
Application
Biomedical Research and Development Material
Emerging infectious disease research
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
fluorescent antibody test
Genome sequencing strain (J. Craig Venter Institute, USA).
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGCCCTCGCGGCCCAACCTCCCACCCTTGTCTCTATACACCTGTTGCTTTGGCGGGCCCACCGGGGCCACCCGGTCGCCGGGGGACGTTTGTCCCCGGGCCCGCGCCCGCCGAAGCGCCCTGTGAACCCTGATGAAGATGGACTGTCTGAGTACCATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGTGGTCCCTCCGGGGACCTGCCCGAAAGGCAGCGGCGACGTCCGTCTGGTCCTCGAGCGTATGGGGCTCTGTCACTCGCTCGGGAAGGACCTGCGGGGGTTGGTCACCACCATATTTACCACGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCCCTTTGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGTCCCCATCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGATGGGCGGCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTGTCCACCAGACTCGCCCGGGGGGGCTCAGCCGGCACGTGTGCCGGTGTACTCCTCTCCGGGCGGGCCAGCATCGGTTTGGGCGGCTGGTGAAAGGCCCCGGGAATGTAACACCCTCCGGGGTGCCTTATAGCCCGGGGTGCCATGCAGCCAGCCTGGACCGAGGCCCGCGCTTCGGCGAGGATGCTGGCGTAATGGTGGTCAACGGC


Beta-tubulin gene

CGTCCTTTCCCCTCCGTTCCCCTCTTTGACGCGTCTCGGGTATTCGTGTTTTGCACAACCCCCTGACCACCCCACTTTGTCTCTGCTCTGGTATGTGTGTTGGAAATGCTACATTGTGCTAATCGATGCTTCTTTCTCGATATAGGTTCACCTCCAGACCGGTCAGTGCGTAAGTATTATCGATGCCATCCTCATGGAATGCTCGCTTTGTCGAAGTGGAAAATAAATATTAAGATCGGGCCATAATAGGGTAACCAAATTGGTGCTGCTTTCTGGTGAGTTTGGCTCTCAACAAACACATCACAACTTTCAGTCACTTGTCGCGACAACACGCTGACTCTTTTCCAGGCAAATCATCTCCGCCGAGCACGGCCTCGACGGCTCCGGTGTGTAAGTATTACACGATTCAAATCCAGCTACAATCCGACAATTATCTGATGATCAACAGCTACAATGGCTCCTCCGACCTCCAGTTGGAGCGTATGAACGTTTACTTCAACGAGGTGCGTCAGACCCTTCCACCTAATAAACCGAAGACGAACTCATCATCATCGATATAGGCTTCCGGCAACAAATATGTCCCCCGTGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTCCGCGCTGGTCCTTTTGGTCAGCTCTTCCGTCCCGACAACTTTGTTTTCGGTCAGTCCGGTGCTGGTAACAACTGG

Name of Depositor QM
Chain of Custody
ATCC <-- QM <-- L. Ajello <-- G. Segretain <-- Capponi et Sureau
Isolation
Bamboo rat, Rhizomys sinensis, Vietnam
Cross References

Nucleotide (GenBank) : L37406 Penicillium marneffei transcribed spacers 1 and 2 and 5.8S

Nucleotide (GenBank) : L37407 Penicillium marneffei mitochondrial small subunit ribosomal RNA

Nucleotide (GenBank) : ABAR01000000 Penicillium marneffei ATCC 18224, whole genome shotgun sequencing project

Nucleotide (GenBank) : JQ354997 Penicillium marneffei strain ATCC 18224 mitochondrial sequence

References

Pitt JI. The genus Penicillium. London: Academic Press; 1979.

Segretain G. Description d'une nouvelle espece de Penicillium: Penicillium marneffei n. sp.. Bull. Soc. Mycol. Fr. 75: 412-416, 1959.

Capponi M, Sureau P, Segretain G. Pénicilliose de Rhizomys sinensis. Bull Soc Pathol Exot 49: 418-421, 1956.

Kaufman L, et al. Development of specific fluorescent-antibody test for tissue form of Penicillium marneffei. J. Clin. Microbiol. 33: 2136-2138, 1995. PubMed: 7559962

Visagie CM, et al. Phylogenetic relationships and the newly discovered sexual state of Talaromyces flavovirens, comb. nov. Mycotaxon 122: 399-411, 2012.

Joardar V, et al. Sequencing of mitochondrial genomes of nine Aspergillus and Penicillium species identifies mobile introns and accessory genes as main sources of genome size variability. BMC Genomics 13: 698, 2012. PubMed: 23234273

Samson RA, et al. Phylogeny and nomenclature of the genus Talaromyces and taxa accommodated in Penicillium subgenus Biverticillium. Stud Mycol 70: 159-183, 2011. PubMed: 22308048

Mekha N, et al. The intergenic spacer region of the ribosomal RNA gene of Penicillium marneffei shows almost no DNA sequence diversity. Microbiol Immunol 54: 714-716, 2010. PubMed: 21155364

Cao C, Liu W, Li R. Penicillium marneffei SKN7, a novel gene, could complement the hypersensitivity of S. cerevisiae skn7 Disruptant strain to oxidative stress. Mycopathologia 168: 23-30, 2009. PubMed: 19294341

Lasker BA. Nucleotide sequence-based analysis for determining the molecular epidemiology of Penicillium marneffei. J Clin Microbiol 44: 3145-3153, 2006. PubMed: 16954240

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation