ATCC 100 Years Logo Anniversary ATCC 100 Years Logo Anniversary Cart 0
  • Quick Order
  • Careers
  • Support

pSCH2009

87419

This is a partial clone of the Klebsiella pneumoniae aac(6?)-Ib gene.  Nucleotides 1-331 of the insert correspond to nucleotides 471 - 801 of the Genbank sequence M21682.A hybridization probe may be generated using the following vector specific PCR primers: Modified T3:5??CCCCTCACTAAAGGGAACAAAAGCTG ? 3?Modified T7:5? ? CGCGTAATACGACTCACTATAGGGCGAA-3?A single gel purification of the PCR generated probe is necessary since flanking regions will co-amplify with the gene specific sequence.  Failure to do so often results in high backgrounds and false positives with clinical E. coli strains.  Due to the sequence similarity between aac(6?)-Ib and aac(6?)-IIa genes, the aac(6?)-Ib probe is used to detect both genes.           - In: Woodford, N; Johnson, A., eds. Methods in molecular medicine: molecular approaches for the diagnosis and investigation of bacterial diseases.  Totowa, NJ: The Humana Press, Inc.; 1996
Organism
Klebsiella pneumoniae (Schroeter) Trevisan
Clone type
Clone
Applications
Molecular biology
Product format
Freeze-dried
Shipping information
Escherichia coli containing the phagemid
Storage conditions
2°C to 8°C
Mission Collection Item
This is a Mission Collection Item.

Documentation

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

Detailed product information

General

Specific applications
Due to sequence similarity between aac(6')-Ib and aac(6')-IIa genes, the aac(6')-Ib probe is used to detect both genes.

Characteristics

Comments
Restriction digests of the clone give the following sizes (kb): HindIII/XhoI--3.0, 0.4; HindIII--3.4; XhoI--3.4.
The insert contains the following restriction sites (approximate kb from the 5' end): ClaI--0.04; ScaI--0.11; SacI--0.32.
A single gel purification of the PCR generated probe is necessary since flanking regions will co-amplify with the gene specific sequence. Failure to do so often results in high backgrounds and false positives with clinical E. coli strains.
Due to sequence similarity between aac(6')-Ib and aac(6')-IIa genes, the aac(6')-Ib probe is used to detect both genes.
A hybridization probe may be generated using the following vector specific PCR primers: modified T3 = 5'-CCCCTCACTAAAGGGAACAAAAGCTG-3' and modified T7 = 5'-CGCGTAATACGACTCACTATAGGGCGAA-3'.
Mycoplasma contamination
Not detected

Vector information

Construct size (kb)
3.299999952316284

Insert information

Insert size (kb)
0.33100000000000002
Type of DNA
cDNA
Gene product
aminoglycoside 6'-N-acetyltransferase [aac(6')-Ib]
Gene symbol
aac(6ʹ)-Ib

Handling information

Medium
Temperature
37°C
Handling procedure
1. Open vial according to instructions.2. aseptically add 0.3 to 0.4 mL of liquid medium to the freeze-dried pellet and mix well.  Transfer 100 uL to a test tube containing 5 mL LB+ ampicillin (50-100 ug/mL). A loopful of culture can also be streaked on an agar plate of the same. Incubate cultures at 370 C. 3. Isolate DNA using standard plasmid preparation procedures.                   
Handling notes
  Restriction digests of the clone gave the following sizes   (in kb):  HindIII/XhoI – 3.0, 0.4 ; HindIII – 3.4 ; XhoI – 3.4.                                                     –ATCC Staff    

History

Depositors
KJ Shaw
Special collection
NCRR Contract
Cross references
GenBank M21682

Legal disclaimers

Intended use
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.
Warranty

The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Permits & Restrictions

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

Frequently Asked Questions

References

Curated Citations

Shaw KJ, et alThe application of molecular techniques for the study of aminoglycoside resistanceIn: Shaw KJ, et alMethods in molecular medicine: molecular approaches for the diagnosis and investigation of bacterial diseasesTotowa, NJHumana Presssubmitted, 1996

For product-related inquiries and issues, contact Product Experience:

Message Us

Hours of Operation

Monday - Friday
9:00am - 5:00pm
US Eastern Time