ATCC ATCC Logo 0

Myceliophthora thermophila (Apinis) van Oorschot

48104

An ampoule containing viable cells (e.g. yeast cells, spores) suspended in cryoprotectant.
Product category
Fungi
Strain designation
D-14
Type strain
No
Isolation source
Garbage
Geographical isolation
Italy
Product format
Freeze-dried
Storage conditions
2°C to 8°C
Buy Now
Price: $550.00 EA
Discounts are available for our fellow nonprofit organizations.

Generally ships within 1-3 business days

Documentation

Haven't found what you need?

Customize solution

We tailor our materials for your specific application.

Get application-specific materials

Biosafety Icon BSL 1

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.

Detailed product information

General

Specific applications
Produces amylase
Produces endoglucanase
Produces glucosidase, beta; acid Glucosidase, beta, acid, glucocerebrosidase
Produces thermostable amylase
Degrades cellulosic wastes
Preceptrol
No

Characteristics

Morphology
After 10 days on Potato dextrose medium at 45°C, colonies are buff turning light brown with age, velutinous; reverse brown. Hyphae hyaline to yellow, guttulate. Conidia ovoid, hyaline, smooth-walled, borne singly or in masses from short protrusions.

Handling information

Medium
Temperature
37-50°C
Atmosphere
Aerobic
Handling procedure

For freeze-dry (lyophilized) ampoules:

  1. Open an ampoule according to enclosed instructions.
  2. From a single test tube of sterile distilled water (5 to 6 mL), withdraw approximately 0.5 to 1.0 mL with a sterile pipette and apply directly to the pellet.  Stir to form a suspension.
  3. Aseptically transfer the suspension back into the test tube of sterile distilled water.
  4. Let the test tube sit at room temperature for (25°C) undisturbed for at least 2 hours; longer (e.g., overnight) rehydration might increase viability of some fungi.
  5. Mix the suspension well.  Use several drops (or make dilutions if desired) to inoculate recommended solid or liquid medium.
  6. Incubate the inoculum/strain at the temperature and conditions recommended.
  7. Inspect for growth of the inoculum/strain regularly. The sign of viability is noticeable typically after 3-5 days of incubation. However, the time necessary for significant growth will vary from strain to strain. 

 

Handling notes
produces amylase, produces endoglucanase, produces glucosidase beta acid, produces glucocerebrosidase, produces thermostably amylase, degrades cellulosic waste.
Additional, updated information on this product may be available on the ATCC web site at www.atcc.org

Quality control specifications

Sequenced data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCCTAAACCATCGTGAACGCTACCTAAACCGTTGCTTCGGCGGGCGGCGCCCTCGCGCGCCCCCCTGGGGCCCGCACCGCGGGCGCCCGCCGGAGGTACACCAAACTCTTGATATGTTATGGCCACTCTGAGTCTCCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATCCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCATCAAGCCCACGGCTTGTGTTGGGGACCTGCGGCTGCCCGCAGGCCCTGAAAACCAGTGGCGGGCTCGCTAGTCACACCGGGCGTAGTAGCATACGACCTCGCTCAGGGCGTGCTGCGGGTTCCAGCCGTAAAACGACCTTCAGAACCCAAGGTTGACCTCGGATCAGGTAGGAGGACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGCAGAGGAAGCTTTAGGCGCGGCACCTTCTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATAGTTGGATGCCTAGCCTGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCTGATCATCCGGTGTTCTCACCGGTGCACTCTGCCCGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGATAAAGGCCCGGGGAATGTAGCTCCTCCGGGAGTGTTATAGCCCCGGGTGTAATACCCTCGCGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGAC

History

Deposited as
Myceliophthora thermophila (Apinis) van Oorschot
Depositors
SL Chakrabarty

Legal disclaimers

Intended use
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.
Warranty

The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Permits & Restrictions

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

References

Curated Citations

Roy SK, et al. Induction and catabolite repression of beta-glucosidase synthesis in Myceliophthora thermophila D-14 (= ATCC 48104). Appl. Environ. Microbiol. 54: 2152-2153, 1988.

Roy SK, et al. Purification and properties of an extracellular endoglucanase from Myceliophthora thermophila D-14 (ATCC 48104). J. Gen. Microbiol. 136: 1967-1971, 1990. PubMed: 2269871

Sen S, et al. Induction of cellulase in Myceliophthora thermophila D-14. Can. J. Microbiol. 29: 1258-1260, 1983.

Sadhukhan RK, et al. Thermostable amylolytic enzymes from a cellulolytic fungus Myceliophthora thermophila D14 (ATCC 48104). Appl. Microbiol. Biotechnol. 33: 692-696, 1990.

Sen S, et al. Utilization of cellulosic wastes by thermophilic fungi. Adv. Biotechnol. 2: 633-637, 1981.

View All Curated Citations for this Product

Frequently Asked Questions

Need assistance with this product? Contact our Technical Support team.

Telephone

Telephone

US and Puerto Rico

800-638-6597

Outside the US

+1-703-365-2700
hours

Hours of Operation

Monday-Friday
9:30am - 5:30pm
US Eastern Time