ATCC 100 Years Logo Anniversary ATCC 100 Years Logo Anniversary Cart 0
  • Quick Order
  • Careers
  • Support

Blastomyces dermatitidis Gilchrist et Stokes

26199

Download Genome Learn about the ATCC Genome Portal
An ampoule containing viable cells (may include spores and mycelia) suspended in cryoprotectant
Product category
Fungi
Strain designation
SCB-2
Type strain
No
Genome sequenced strain
Yes
Product format
Frozen
Storage conditions
-80°C or colder
Mission Collection Item
This is a Mission Collection Item.

Documentation

Biosafety level 3 is applicable to any facility where work is performed with indigenous or exotic agents that may cause serious or potentially lethal disease through inhalation. Laboratory personnel must receive specific training in handling pathogenic, potentially lethal agents and must be supervised by scientists competent in handling infectious agents. ATCC determines the biosafety level of a material based on our risk assessment and as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.

Detailed product information

General

Specific applications
Biomedical Research and Development Material
Emerging infectious disease research
Preceptrol
No

Characteristics

Comments
Experimental infection in mice and model of pulmonary blastomycosis
Macrophage induction
Genome sequencing strain (The Genome Sequencing Center (GSC) at Washington University, USA).

Handling information

Medium
This product information is not available online. Due to the nature of this product, we only provide this information to customers who have purchased this biosafety level 3 product. If you have purchased this product, please contact Product Experience for this product information.
Temperature
This product information is not available online. Due to the nature of this product, we only provide this information to customers who have purchased this biosafety level 3 product. If you have purchased this product, please contact Product Experience for this product information.
Atmosphere
This product information is not available online. Due to the nature of this product, we only provide this information to customers who have purchased this biosafety level 3 product. If you have purchased this product, please contact Product Experience for this product information.
Handling procedure
This product information is not available online. Due to the nature of this product, we only provide this information to customers who have purchased this biosafety level 3 product. If you have purchased this product, please contact Product Experience for this product information.
Handling notes
This product information is not available online. Due to the nature of this product, we only provide this information to customers who have purchased this biosafety level 3 product. If you have purchased this product, please contact Product Experience for this product information.

Quality control specifications

Sequenced data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

CATTAACGCGCCGTGGGGGGTTGGACCTCCTAGACCGGAGGAACCCCGGCCCCCTCACCTGGCCACCCTTGTCTATTTTTACCTGTTGCTTCGGCGGGCCTGCAGCGATGCTGCCGGGGGAGTTTTCACTCCCCGGGCTCGTGCCCGCCGAGGACACCGCTAGAACTTCTGGTGAACGATTGACATCTGAGAAAATAACTATAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCGCGGCTTGTGTGTTGGGCCTTCGTCCCCCCGTGGACGTGCCCGAAATGCAGCGGCGGCGTCGTGTTCCGGTGCCCGAGCGTATGGGGCTTTGTCACCCGCTCTAGAGGCCCGGCCGGCTCCGGCCCCATCTCAAACCCTTCGAGGGAGGGCGGTCTTCGGGCCGGTCTCCCCACCAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAG

Verification method
Whole-genome Sequencing

History

Deposited as
Blastomyces dermatitidis Gilchrist et Stokes
Synonyms
Blastomyces tulanensis
Depositors
RA Cox
Chain of custody
ATCC <-- RA Cox <-- AF DiSalvo
Type of isolate
Human
Cross references
GenBank M63096 Blastomyces dermatitidis 18S ribosomal RNA.
GenBank U37772 Ajellomyces dermatitidis WI-1 adhesin gene, complete cds.
GenBank AF159367 Ajellomyces dermatitidis bacterial-type chitinase (CTS1) mRNA,
GenBank AEII00000000 Ajellomyces dermatitidis ATCC 26199, whole genome shotgun sequencing project

Legal disclaimers

Intended use
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.
Warranty

The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Permits & Restrictions

United States Veterinary Permit for Importation and Transportation of Controlled Materials and Organisms and Vectors

For every order of this item requring interstate transport, you must provide a valid Permit for Importation and Transportation of Controlled Materials and Organisms and Vectors (VS Form 16-6A) obtained from the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Service. For information on filling out VS Form 16-6A, read our compliance and domestic shipment document to learn the common mistakes to avoid.

Note: These are considered organisms & vectors and are categorized as livestock or poultry pathogens, not diagnostic or tissue samples. We cannot ship this item until we receive this permit.

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

Frequently Asked Questions

References

Curated Citations

Brummer E, et al. Macrophages and fungi: in vitro effects of method of macrophage induction, activation by different stimuli, and soluble factors on Blastomyces. J. Reticuloendothel. Soc. 28: 507-518, 1980. PubMed: 7463412

Harvey RP, et al. Mouse model of pulmonary blastomycosis: utility, simplicity, and quantitative parameters. Am. Rev. Respir. Dis. 117: 695-703, 1978. PubMed: 646221

Hogan LH, Klein BS. Transforming DNA integrates at multiple sites in the dimorphic fungal pathogen Blastomyces dermatitidis. Gene 186: 219-226, 1997. PubMed: 9074500

Sorensen KN, et al. Murine models of blastomycosis, coccidioidomycosis, and histoplasmosis. Mycopathologia 146: 53-65, 1999.

Shearer G Jr., Larsh HW. Chitin synthetase from the yeast and mycelial phases of Blastomyces dermatitidis. Mycopathologia 90: 91-96, 1985. PubMed: 3159966

View All Curated Citations for this Product

For product-related inquiries and issues, contact Product Experience:

Message Us

Hours of Operation

Monday - Friday
9:00am - 5:00pm
US Eastern Time