ATCC ATCC Logo 0

Lodderomyces elongisporus (Recca et Mrak) van der Walt

11503

Download Genome Learn about our Enhanced Authentication Initiative
An ampoule containing viable cells (may include spores and mycelia) suspended in cryoprotectant.
Product category
Fungi
Product type
Yeast
Strain designation
78 [CBS 2605, CCRC 21390, DBVPG 6183, IFO 1676, JCM 1781, NRRL YB-4239]
Type strain
Yes
Genome sequenced strain
Yes
Isolation source
Concentrated orange juice
Geographical isolation
United States; California
Applications
Industrial biotechnology
Product format
Freeze-dried
Storage conditions
2°C to 8°C
Mission Collection Item
This is a Mission Collection Item

Documentation

Haven't found what you need?

Customize solution

We tailor our materials for your specific application.

Get application-specific materials

Biosafety Icon BSL 1

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.

Detailed product information

General

Preceptrol
No

Characteristics

Comments
Genome sequencing strain (Broad Institute, USA).

Handling information

Medium
Temperature
24-26°C
Atmosphere
Aerobic
Handling procedure
For freeze-dry (lyophilized) ampoules:
  1. Open an ampoule according to enclosed instructions.
  2. From a single test tube of sterile distilled water (5 to 6 mL), withdraw approximately 0.5 to 1.0 mL with a sterile pipette and apply directly to the pellet.  Stir to form a suspension.
  3. Aseptically transfer the suspension back into the test tube of sterile distilled water.
  4. Let the test tube sit at room temperature (25°C) undisturbed for at least 2 hours; longer (e.g., overnight) rehydration might increase viability of some fungi.
  5. Mix the suspension well.  Use several drops (or make dilutions if desired) to inoculate recommended solid or liquid medium. Include a control that receives no inoculum.
  6. Incubate the inoculum at the propagation conditions recommended.
  7. Inspect for growth of the inoculum/strain regularly. The sign of viability is noticeable typically after 1-2 days of incubation. However, the time necessary for significant growth will vary from strain to strain. 
Handling notes
No special notes.

Additional, updated information on this product may be available on the ATCC® web site at www.atcc.org<.

Quality control specifications

Sequenced data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAATTTTGAGAATTGTGCTTAACTGCACTTTTCTTATCTACACACGTGTTTTTGTTTTATTCTTAAAACTTGCTTTGGCAGTGGCTGCTTAATTGCTCTGCTGCCAGAGGATAAACTCAACCTAAATTTTTTATTTTAAACTAGTCAACTGATTATATTTATTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCCCGGGTTTGGTGATGAGCAATACGCCAGGTTTGCTTGAAAGTTAGGAGGAGTATTTATAACAATGTATTAGGTCTAACCACTCCATTGTGCTTAATAAAAAGCTCCAATCTATATTTCAAACTTCGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTAGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCTAGATCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTCTCTCGGGGGTGGCCTCTACAGTTTACCGGGCCAGCATCAGTTTGAGCGGTAGGAGAATTGCGTAGGAATGTGGCTCGGCCTCGGTCGAGTGTTATAGCCTTCGTCGATACTGCCAGCTTAGACTGAGGACTGCGGCTTCGGCCTAGGATGTTGGCATAATGATCTTAAGTCGC

Verification method
Whole-genome Sequencing

History

Deposited as
Saccharomyces elongisporus Recca et Mrak
Depositors
JA Recca
Type of isolate
Food & Beverage
Cross references
GenBank HQ876050 D1/D2 region of 28S rRNA gene
GenBank HQ876042 ITS including 5.8S rRNA gene
GenBank HQ876033 18S rRNA gene
GenBank KC507435 EF-1 alpha gene
GenBank KC507404 RPB1 gene
GenBank KC512830 RPB2 gene
GenBank AAPO00000000 Lodderomyces elongisporus NRRL YB-4239, whole genome shotgun sequencing project

Legal disclaimers

Intended use
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.
Warranty

The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Permits & Restrictions

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

References

Curated Citations

Butler G, et al. Evolution of pathogenicity and sexual reproduction in eight Candida genomes. Nature 459: 657-662, 2009. PubMed: 19465905

Suh SO, et al. Scheffersomyces parashehatae f.a., sp. nov., Scheffersomyces xylosifermentans f.a., sp. nov., Candida broadrunensis sp. nov., and Candida manassasensis sp. nov., four novel yeasts associated with wood- ingesting insects and their ecological and biofuel implications. Int. J. Syst. Evol. Microbiol. 63: 4330-4339, 2013. PubMed: 24014624

van der Walt JP. Lodderomyces, a new genus of the Saccharomycetaceae. Antonie van Leeuwenhoek 32: 1-5, 1966. PubMed: 5296604

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262

Tsui CK, et al. Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses. FEMS Yeast Res. 8: 651-659, 2008. PubMed: 18248416

View All Curated Citations for this Product

Frequently Asked Questions

Need assistance with this product? Contact our Technical Support team.

Telephone

Telephone

US and Puerto Rico

800-638-6597

Outside the US

+1-703-365-2700
hours

Hours of Operation

Monday-Friday
9:30am - 5:30pm
US Eastern Time