ATCC 100 Years Logo Anniversary ATCC 100 Years Logo Anniversary Cart 0
  • Quick Order
  • Careers
  • Support

pICL

77408

Clone type
Vector
Applications
Molecular biology
Product format
Freeze-dried
Buy Now
Price: $639.00 EA
Discounts may be available for our fellow nonprofit organizations. Login to see your price.

Generally ships within 1-3 business days

Documentation

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

Detailed product information

General

Specific applications
vector for other uses

Characteristics

Comments
Restriction digests of the clone give the following sizes (kb): KpnI--6.3, 1.5, 0.6; SstI--8.4; BamHI--4.6, 3.8.
Linearized vector is transformed into the YAC-containing yeast cells, followed by plating on medium lacking lysine and uracil (and containing 10 mg/L adenine to enhance the red color phenotype of recombinant clones).
Positive colonies should have the rescue plasmid integrated into the YAC clone near the ScaI site in the beta-lactamase (ampR) gene.
Correctly integrated products will yield a 870 bp amplification product, that should be cleaved by PstI into two fragments: 705 bp and 165 bp.
YAC end fragment clones can be isolated from properly integrated DNA by digestion with one of the enzymes in the polylinker, religation by circularization, and transformation into Escherichia coli.
The order of the major features in a rcombinant YAC end fragment clone would be: T7 promoter - BamHI/polylinker/SacI - CEN end YAC insert - EcoRI - CEN - ARS - (TRP) - ScaI/ampR - pMB1 ori.
TRP from pYAC4 is not really functional.
Vector designed to rescue the CEN end of an insert from a yeast artificial chromosome (YAC) constructed in a pYAC4-derived vector. Based on homologous recombination with the pYAC vector.
DNA from positive colonies can be screened for proper integration of the vector using the following primers: 5'- GCGCTTAATGCGCCGCTACAGGGCG -3' and 5'- GCTCACCGGCTCCAGATTTATCAGC -3', complementary to the f1 ori and ampR sequences respectively.
The order of the major features of the rescue vector is: T7 promoter - SacI/polylinker/BamHI - LYS2 - XbaI - SphI - ScaI/ampR - pMB1 ori.
Mycoplasma contamination
Not detected

Vector information

Construct size (kb)
8.399999618530273
Vector name
pICL (plasmid)
Type of vector
plasmid
Construction
pTZ18R, pI-L13
Markers
LYS2; ampR
Promoters
T7 (phi10)
Replicon
pMB1; ARS1

Handling information

History

Depositors
GG Hermanson

Legal disclaimers

Intended use
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.
Warranty

The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Permits & Restrictions

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

Frequently Asked Questions

References

Curated Citations

Hermanson GG, et al. Rescue of end fragments of yeast artificial chromosomes by homologous recombination in yeast. Nucleic Acids Res. 19: 4943-4948, 1991. PubMed: 1923762

Gary G Hermanson, personal communication

For product-related inquiries and issues, contact Product Experience:

Message Us

Hours of Operation

Monday - Friday
9:00am - 5:00pm
US Eastern Time