Saccharomyces bayanus Saccardo (ATCC® 76518)

Strain Designations: CBS 7001 [MCYC 623, NCYC 2669, NRRL Y-11845]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations CBS 7001 [MCYC 623, NCYC 2669, NRRL Y-11845]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes (type strain of Saccharomyces abuliensis)
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Broad Institute, USA).
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

AAGGATCATTAAAGAAATTTAATAATTTTGATATTGGATTTTTTTGTTTTGGCAAGAGCGTGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGCAAATTTCTTTCTTGCTATTCCAAACAGTGAGACTTCTCTGTTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTTATACTTTTGCAACTTTTTCTTTGGGCTTCGAGCAATCGAGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAAATAATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTCTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTGTACTGAGCGTATTGAAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAG


D1D2 region of the 26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGACCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTATGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCTCTGCTCCTTGTGGGTGGGGGAATCTCGCAGTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCGTAGGAATGTAACTTGCTTCGGGAAGTATTATAGCCTATGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCG

Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- J. Santa Maria
Isolation
Mesophylax adopersus, Spain
Cross References

Nucleotide (GenBank) : AACA00000000 Saccharomyces uvarum MCYC 623, whole genome shotgun sequencing project

References

Rosenblad MA, et al. Kinship in the SRP RNA family. RNA Biol. 6: 508-516, 2009. PubMed: 19838050

Cliften P, et al. Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 30: 71-76, 2003. PubMed: 2775844

Andersen ES, et al. The tmRDB and SRPDB resources. Nucleic Acids Res. 34: D163-D168, 2006. PubMed: 16381838

Liti G, et al. Inferences of evolutionary relationships from a population survey of LTR-retrotransposons and telomeric-associated sequences in the Saccharomyces sensu stricto complex. Yeast 22: 177-192, 2005. PubMed: 15704235

Dandjinou AT, et al. A phylogenetically based secondary structure for the yeast telomerase RNA. Curr Biol 14: 1148-1158, 2004. PubMed: 15242611

Van Nues RW, Brown JD. Saccharomyces SRP RNA secondary structures: a conserved S-domain and extended Alu-domain. RNA 10: 75-89, 2004. PubMed: 14681587

Langkjaer RB, et al. Yeast genome duplication was followed by asynchronous differentiation of duplicated genes. Nature 421: 848-852, 2003. PubMed: 12594514

Fischer G, et al. Evolution of gene order in the genomes of two related yeast species. Genome Res 11: 2009-2019, 2001. PubMed: 11731490

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262

Bon E, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 5. Saccharomyces bayanus var. uvarum. FEBS Lett. 487: 37-41, 2000.

Souciet JL, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 1. A set of yeast species for molecular evolution studies. FEBS Lett. 487: 3-12, 2000.

Kellis M, et al. Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423: 241-254, 2003.

Santa Maria J. Biotaxonomic studies on yeast. Commun. Inst. Nac. Invest. Agrar. Ser. Gen. 3: 1-61, 1978.

type strain of Saccharomyces abuliensis

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation