Sporothrix schenckii Hektoen et Perkins, anamorph (ATCC® 26331)

Strain Designations: Nixon (C 31)  /  Product Format: freeze-dried

Strain Designations Nixon (C 31)
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
Pathogenic to BALB/C mice
Experimental sporotrichosis
Creatine and creatinine assimilation
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 25.0°C
Sequenced Data
       18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GAACCTGCGGAGGGATCATTACAGAGTTTTCACAACTCCCAACCCTTGCGAACCGTACCCAATCTCGTTCTCGTTGCTTCTGGCGGGGGGGAGCGGGGGGGCGCCCGACACGGCCCCCTCTGCCCCCGCCCGCCAGGGGCGGCGGGCCCTACGAACCTTTGTATCTCAACCACTAGAAAACCGTCTGAGGAAAAAACAAAATAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGCGAACCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCCCCCCTCACGCGCCCCGTTGCGCGCTGGTGTTGGGGCGCCCTCCGCCTGGCGGGGGGCCCCCGAAAGCGAGTGGCGGGCCCTGTGGAAGGCTCCGAGCGCAGTACCGAACGCATGTTCTCCCCTCGCTCCGGACGCCCCCCAGGCGCCCTGCCGTGAAAACGCGCATGACGCGCAGCTCTTTTTACAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA

Name of Depositor F Staib
Chain of Custody
ATCC <<--F Staib<<--W. Kaplan
Isolation
human sputum, Georgia
Cross References

Nucleotide (GenBank) : FJ545232 ITS including 5.8S rRNA gene

References

Staib F, et al. Creatine and creatinine assimilation by Sporothrix schenckii. Zentralbl. Bakteriol., I Abt., Orig. A221: 94-99, 1972.

Staib F, et al. Observations on experimental sporotrichosis of the muscle. Zentralbl. Bakteriol., I Abt., Orig. A221: 250-256, 1972.

Tachibana T, et al. Characteristic infectivity of Sporothrix schenckii to mice depending on routes of infection and inherent fungal pathogenicity. Med. Mycol. 36: 21-27, 1998. PubMed: 9776808