Sporothrix schenckii Hektoen et Perkins, anamorph (ATCC® 26331)

Strain Designations: Nixon (C 31)  /  Product Format: freeze-dried

Strain Designations Nixon (C 31)
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
Pathogenic to BALB/C mice
Experimental sporotrichosis
Creatine and creatinine assimilation
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 25.0°C
Sequenced Data
       18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GAACCTGCGGAGGGATCATTACAGAGTTTTCACAACTCCCAACCCTTGCGAACCGTACCCAATCTCGTTCTCGTTGCTTCTGGCGGGGGGGAGCGGGGGGGCGCCCGACACGGCCCCCTCTGCCCCCGCCCGCCAGGGGCGGCGGGCCCTACGAACCTTTGTATCTCAACCACTAGAAAACCGTCTGAGGAAAAAACAAAATAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGCGAACCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCCCCCCTCACGCGCCCCGTTGCGCGCTGGTGTTGGGGCGCCCTCCGCCTGGCGGGGGGCCCCCGAAAGCGAGTGGCGGGCCCTGTGGAAGGCTCCGAGCGCAGTACCGAACGCATGTTCTCCCCTCGCTCCGGACGCCCCCCAGGCGCCCTGCCGTGAAAACGCGCATGACGCGCAGCTCTTTTTACAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA

Name of Depositor F Staib
Chain of Custody
ATCC <<--F Staib<<--W. Kaplan
Isolation
human sputum, Georgia
Cross References

Nucleotide (GenBank) : FJ545232 ITS including 5.8S rRNA gene

References

Staib F, et al. Creatine and creatinine assimilation by Sporothrix schenckii. Zentralbl. Bakteriol., I Abt., Orig. A221: 94-99, 1972.

Staib F, et al. Observations on experimental sporotrichosis of the muscle. Zentralbl. Bakteriol., I Abt., Orig. A221: 250-256, 1972.

Tachibana T, et al. Characteristic infectivity of Sporothrix schenckii to mice depending on routes of infection and inherent fungal pathogenicity. Med. Mycol. 36: 21-27, 1998. PubMed: 9776808