Aspergillus carbonarius (Bainier) Thom (ATCC® 8740)

Strain Designations: NRRL 67 [67 (Monospore 4); 4707.878, CBS 420.64, DSM 872, IMI 41875, MUCL 30479, NRRL 1737, NRRL 605, QM 330, WB 67, Wis. (old series) 62]  /  Product Format: freeze-dried

Deposited As Aspergillus niger van Tieghem
Strain Designations NRRL 67 [67 (Monospore 4); 4707.878, CBS 420.64, DSM 872, IMI 41875, MUCL 30479, NRRL 1737, NRRL 605, QM 330, WB 67, Wis. (old series) 62]
Application
Oxidizes lincomycin
Produces citric acid citrate
Produces fonsecin
Produces gluconic acid
Produces lincomycin sulfoxides
Produces rubrofusarin
Produces fonsecinones A, B, C, and D
Produces aurosperones A and B
Produces lincomycin sulfoxides by oxidation of corresponding lincomycins
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCACCCGTGTCTATTGTACCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCATCTCTGCCCCTCGGGCCCGTGCCCGCCGGAGACACCAACACGAACACTGTCTGAAATCGTGAAGTCTGAGTCGATTGTTTTCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTGTCTGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACAACTCCAACCTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGAGTCCGCATTGTAATTTGCAGAGGATGCTTTGGGTGCGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGGTGTCCGTGCCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCTGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCAGGGGTGCAATGCGGCCAGCCTAGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTTGTAAACGAC


Beta-tubulin gene

TGTTCCCCGGACCCCTAGTCCCTCAGGAGACGCGTCGTCGTTGGCTGGCATCTCTCCTGATGGGGACCCCACCGGTTCTCTTGACCAACTCAATTTTGCTAACTGCATGTCTTCTTAACTTCATAGGTTCACCTCCAAACCGGCCAGTGTGTAAGTGCGACCATGTCTTGGGATTGTCGTCCAAGTGCCATGCTTGGTGTCCAGTGAACTAAACAATGATGGCGAATAGGGTAACCAAATTGGTGCTGCTTTCTGGTATGTCTCCCGGTCACTAGACTTGGGATGGGATCTATCTCAGGCTTTGTAGCATGAGTCTAGATGCCCATTGTTACTCTTGCTTCGGAACTCATCTAACAACCCAACAGGCAGACCATCTCTGGTGAGCACGGCCTCGACGGCACCGGTGTGTAAGTACACCCTTTTCACGTCTCAATCGGTCAACATAACGGAAGAATCGGGTTCCTGACGTGGAGGATAGTTACAATGGCACCTCCGATCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGTGGGTGTCAACCAATCCTAGGTTTTACCACGTGTACATGTGGTGTCTCGATTCCTGACTCCTTCACCAGGCTAGCGGCAACAAGTATGTTCCTCGTGCCGTCCTTGTCGACCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCTGGTAACAACTGG

Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- A.J. Moyer 67 (Monospore 4) <-- C. Thom 4707.878 <-- O.O.R. da Fonseca (Sterigmatocystis fusca)
Isolation
Brazil
References

Argoudelis AD, Mason DJ. Production of lincomycin sulfoxide. US Patent 3,616,244 dated Oct 26 1971

Moyer AJ, et al. Gluconic acid production: Development of inoculum and composition of fermentation solution for gluconic acid production by submerged mold growths under increased air pressure. Ind. Eng. Chem. 29: 777-781, 1937.

Galmarini OL, et al. Two novel metabolites of Aspergillus fonsecaeus. Experientia 30: 586, 1974. PubMed: 4837062

Priestap HA. New naphthopyrones from Aspergillus fonsecaeus. Tetrahedron 40: 3617-3624, 1984.

Gerhardt P, et al. Citric acid fermentation of beet molasses. J. Bacteriol. 52: 555-564, 1946.

Peterson SW. Phylogenetic analysis of Aspergillus species using DNA sequences from four loci. Mycologia 100: 205-226, 2008. PubMed: 18595197

Serra R, et al. Aspergillus ibericus: a new species of section Nigri isolated from grapes. Mycologia 98: 295-306, 2006. PubMed: 16894975