Malassezia globosa Midgley, E. Guého et J. Guillot (ATCC® MYA-4612)

Strain Designations: CBS 7966 [ATCC 96807, GM 35]  /  Product Format: frozen

Strain Designations CBS 7966 [ATCC 96807, GM 35]
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Lipophilic or lipid-dependent yeasts
Genome sequencing strain (The Procter & Gamble Company, USA; Genome Institute of Singapore, Singapore)
Opportunistic pathogen that can cause systematic infection in neonates and are associated with multiple human skin disorders
Medium ATCC® Medium 2737: Modified Leeming & Notman Agar (MLNA)
ATCC® Medium 2693: modified Dixon (mDixon)
Growth Conditions
Temperature: 30°C to 35°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCTGTAGGTGAACCTGCAGAAGGATCATTAGTGAAGATTCAAGGGCCAGCCATACAGACGTACAATAAGTGTGTCTCTGGCGGCTCGTATCCACTATACATCCATAAACCCGTGTGCACTGTTAAGGAGTAAGAAAGAAGGGGAGGGAGAGAGTGCATGTGCTTTGCATATAACTCTCTCTCTTTCTCTTCCTTTCTCTCTCTGGTTAATTACACAAACTCGTATGGATTTGTATGAACGTGAGATATATCGTTGGACCGTCACTGGCCAACAAATATAACACAACTTTCGACAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAAACGCGATAGGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTATGGTATTCCGTAGAGCATGCCTGTTTGAGTGCCGTGAATTCTCCCATCCCAAGCGGTTTTTATCAAAGAATTGCTAGGCGAAGGGGTTGAGATGGGCGTTGTTATAACTGCTTTTCTTCTCTAGAAAAGCTCGCCCGAAAAACAGCTAACGCCTCTGGGCCACTTTGCATCCGCTTCTCTGAGGGGAGAAGCGGCCAAGCGCGCTCTGATCATCAGGCATAGCATGATACGTCATTTGCTATGCTGTAGGAGAGCATTTGGTTGTGGTTATACCGCGTGCGTCATTTTTTTTTTTGCAAACGCAAAGAAAAAAGCCCCCTTTCATTTCTGGTCTCAAATCAGGTAGGATCACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGCGAAGCGGGAAGAGCTCAAATTTGAAAGCTGGCACCTCCGGTGTCCGCGTTGTAATCTCGAGACGTGTTTTCCGTGCGGCTCTATGGACAAGTCCCTTGGAATAGGGCATCGTAGAGGGTGAGAATCCCGTACTTGCCATGGAAGAACCGTGCTTTGCGATACACGCTCTAAGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGTGGTAGACTCCATCTAAAGCTAAATATCGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTCGAAAGGGAAGCACTTGAAGTCAGCCATGCTGCTTGAGACTCAGCCTGGCCTTTGGGCTTGGTGTATTTCTCGGTGGCAAGCCAGCATTGGTTTGGGTCGTCGGAGAAGCGCATAGGGAATGTAGCGTCTCCGGACGTGTTATAGCCTTATGCAGGATACGACGACCTGGATCAAGGAACGCAGTGTGCCCTCTGGGCGGGTCTTCGGACACCTTCACACTTAGGATGCTGGCGTAATGGCTTTAAGTGGC

Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS
Isolation
Skin of patient with Pityriasis versicolor, London, UK.
Cross References

Nucleotide (GenBank) : GU291287 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : GU291271 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : AAYY00000000 Malassezia globosa CBS 7966, whole genome shotgun sequencing project

References

Gueho E, Midgley G, Guillot J. The genus Malassezia with description of four new species. Antonie van Leeuwenhoek 69: 337-355, 1996. PubMed: 8836432

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262

Xu J, et al. Dandruff-associated Malassezia genomes reveal convergent and divergent virulence traits shared with plant and human fungal pathogens. Proc Natl Acad Sci USA 104: 18730-18735, 2007. PubMed: 18000048

Kim D, et al. Functional expression and characterization of CYP51 from dandruff-causing Malassezia globosa. FEMS Yeast Res 11: 80-87, 2011.

Castellá G, Coutinho SD, Cabañes FJ. Phylogenetic relationships of Malassezia species based on multilocus sequence analysis. Med. Mycol. 52: 99-105, 2014. PubMed: 23902157

Cabañes FJ, et al. Two New lipid-dependent Malassezia species from domestic animals. FEMS Yeast Res. 7(6): 1064-1076, 2007. PubMed: 17367513

Cabanes FJ, Hernandez JJ, Castella G. Molecular analysis of Malassezia sympodialis-related strains from domestic animals. J Clin Microbiol 43: 277-283, 2005. PubMed: 15634983

Gupta AK, et al. Identification and typing of Malassezia species by amplified fragment length polymorphism and sequence analyses of the internal transcribed spacer and large-subunit regions of ribosomal DNA. J Clin Microbiol 42: 4253-4260, 2004. PubMed: 15365020