To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X

Saccharomyces cerevisiae Meyen ex E.C. Hansen (ATCC® 18824)

Alternate State: Candida robusta Diddens et Lodder  /  Strain Designations: CBS 1171 [CCRC 21447, DBVPG 6173, DSM 70449, IFO 10217, IGC 4455, JCM 7255, NCYC 505, NRRL Y-12632]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Saccharomyces cerevisiae Hansen
Classification Fungi, Ascomycota, Saccharomycotina, Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomyces
Strain Designations CBS 1171 [CCRC 21447, DBVPG 6173, DSM 70449, IFO 10217, IGC 4455, JCM 7255, NCYC 505, NRRL Y-12632]
Alternate State Candida robusta Diddens et Lodder
Application
DNA fingerprinting and RAPD analysis
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Genotype [cir+]
Preceptrol® no
Comments
DNA fingerprinting and RAPD analysis
Mitochondrial ori-rep-tra sequences
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
26S ribosomal RNA gene, partial sequence

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCATT


18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TCATTAAAGAAATTTAATAATTTTGAAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGT

Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- AC van Wijk
Isolation
Top yeast, the Netherlands
Cross References

Nucleotide (GenBank) : U44806 26S ribosomal RNA gene, partial sequence

Nucleotide (GenBank) : KC881067 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KC881066 D1/D2 region of 26S rRNA gene

Nucleotide (GenBank) : KC881096 RPB1 gene

Nucleotide (GenBank) : KC881093 RPB2 gene

Nucleotide (GenBank) : KC881098 Elongation factor 1-alpha gene

References

Hansen EC. Undersogelser over alkoholgjaersvampenes fysiologi og morfologi. II. Om askosporedannelsen hos slaegten Saccharomyces. Medd. Carlsberg Lab. 2: 29-86, 1883.

Piskur J, et al. A mitochondrial molecular marker, ori-rep-tra, for differentiation of yeast species. Appl. Environ. Microbiol. 61: 2780-2782, 1995. PubMed: 7618892

Naumova ES, et al. Genetic variation among European strains of Saccharomyces paradoxus: results from DNA fingerprinting. Syst. Appl. Microbiol. 23: 86-92, 2000. PubMed: 10879982

Kurtzman CP, Robnett CJ. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol 35: 1216-1223, 1997. PubMed: 9114410

Kurtzman CP, Robnett CJ. Relationships among genera of the Saccharomycotina (Ascomycota) from multigene phylogenetic analysis of type species. FEMS Yeast Res. 13: 23-33, 2013. PubMed: 22978764

Kurtzman CP, Robnett CJ. Systematics of methanol assimilating yeasts and neighboring taxa from multigene sequence analysis and the proposal of Peterozyma gen. nov., a new member of the Saccharomycetales. FEMS Yeast Res 10: 353-361, 2010. PubMed: 20522116

Ezeronye OU, Legras JL. Genetic analysis of Saccharomyces cerevisiae strains isolated from palm wine in eastern Nigeria. Comparison with other African strains. J. Appl. Microbiol. 106: 1569-1578, 2009. PubMed: 19191945

Huang CH, Lee FL, Tai CJ. The beta-tubulin gene as a molecular phylogenetic marker for classification and discrimination of the Saccharomyces sensu stricto complex. Antonie van Leeuwenhoek 95: 135-142, 2009. PubMed: 19112604

Liu ZL, Moon J. A novel NADPH-dependent aldehyde reductase gene from Saccharomyces cerevisiae NRRL Y-12632 involved in the detoxification of aldehyde inhibitors derived from lignocellulosic biomass conversion. Gene 446: 1-10, 2009. PubMed: 19577617

Nguyen HV, Gaillardin C. Evolutionary relationships between the former species Saccharomyces uvarum and the hybrids Saccharomyces bayanus and Saccharomyces pastorianus; reinstatement of Saccharomyces uvarum (Beijerinck) as a distinct species. FEMS Yeast Res. 5: 471-483, 2005. PubMed: 15691752

Ganley AR, et al. Identifying gene-independent noncoding functional elements in the yeast ribosomal DNA by phylogenetic footprinting. Proc. Natl Acad. Sci. USA 102: 11787-11792, 2005. PubMed: 16081534

van der Aa Kuhle A, Jespersen L. The taxonomic position of Saccharomyces boulardii as evaluated by sequence analysis of the D1/D2 domain of 26S rDNA, the ITS1-5.8S rDNA-ITS2 region and the mitochondrial cytochrome-c oxidase II gene. Syst. Appl. Microbiol. 26: 564-571, 2003. PubMed: 14666985

Kurtzman CP, Robnett CJ. Phylogenetic relationships among yeasts of the 'Saccharomyces complex' determined from multigene sequence analyses. FEMS Yeast Res 3: 417-432, 2003. PubMed: 12748053

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation