Acremonium alcalophilum Okada, anamorph (ATCC® 90507)

Strain Designations: JCM 7366 [CBS 114.92, IMI 351927, PA-2M]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations JCM 7366 [CBS 114.92, IMI 351927, PA-2M]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain yes RefOkada G, et al. Acremonium alcalophilium, a new alkalophilic celluloytic hyphomycete. Trans. Mycol. Soc. Jpn. 34: 171-185, 1993.
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute (JGI) at the Department of Energy, USA).
Medium ATCC® Medium 2758: Oatmeal Agar w/ 2N KOH
Growth Conditions
Temperature: 25°C
pH: requires high pH for growth (alkaliphilic)
Sequenced Data
       18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TGCGGAGGGATCATTACAGAGTGTTTTTCCAACCTCATAACCCTATGTGAACCTATATACCACGTTGCTTCGGCGGCGCGTCCCCCCGGGGTCGTGCCCGCCGGCGTTAACCAGTCTCTCAGTCATGAACCGACGTTACTTCTGAGTGTTCTAAGCGAACTGTTAAAACTTTCAACAACGGATCTCTTGGCTCCAGCATCGATGAAGAACGCAGCGAAACGCGATATGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTCCCAGTATCCTGGGAGGCATGCCTGTCCGAGCGTCGTTTCAACCCTCGAGCCCCCGTGGCCCGGTGTTGGGGAACCGCGAGCGAGAGCTCCCGCGGTCCCCGAAATGCAGTGGCGGTCCCGCAGCGTCCCGGCCCTTTGCGTAGTAATTATCGCTCGCATTGGCAGGCCCGCGGGTTACCAGCCTTGAAACCCCCTACAAAGACCGCTCCGGCGGCACGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCATA

Name of Depositor JCM
Chain of Custody
ATCC <<--JCM<<--G. Okada PA-2M
Isolation
sludge of pig manure compost, Kanagawa, Japan
References

Okada G, et al. Acremonium alcalophilium, a new alkalophilic celluloytic hyphomycete. Trans. Mycol. Soc. Jpn. 34: 171-185, 1993.

type strain

Okada G, et al. Acremonium alcalophilium, a new alkalophilic celluloytic hyphomycete. Trans. Mycol. Soc. Jpn. 34: 171-185, 1993.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation