To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. Our first job is to listen to and observe what our customers need, and meet those needs with quality products and services. While we are not currently experiencing delays due to this pandemic, we expect that we could see them as the situation evolves. If you experience any issues, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you for your understanding, patience and flexibility as ATCC does everything it can to help reduce the impact of the coronavirus pandemic to our valued customers.
X

Monascus purpureus Went (ATCC® 16365)

Strain Designations: CBS 109.07 [ATCC 16426, IFO 4513, IMI 210765, NRRL 1596]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Monascus purpureus Went
Strain Designations CBS 109.07 [ATCC 16426, IFO 4513, IMI 210765, NRRL 1596]
Application
produces citrinin antimycin
produces red pigment
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.
Preceptrol® no
Comments Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACCGAGTGCGGGTCCCCTTCGTGGGACCCAACCTCCCACCCGTGATTATTGTACCTCCTGTTGCTTCGGCGCGGCCCCCTGGGGCCCGCCGGAGACATCTTCTCGAACGCTGTCTTTGAAAAGGATTGCTGTCTGAGTAAACATACCAAATCGGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACTGCCCCTCAAGCGCGGCTTGTGTGTTGGGCCGCCGTCCCCTGCGCCTCCGGGCAACGGGGACGGGCCCGAAAGGCAGTGGCGGCGCCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCAGTAGGTCGGGCCGGGGCCTTTGCCCTCTCCAACCTTTTTTTCCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTCCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGCTCAGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCGGAGAGGGTGAGAATCCCGTCTGGGACGGGGTGCCTGGGTCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGATCAGACTCGCCTGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTCGGGTGGCCGGTCAAAGGCCCCGGGAATGTGTCGCCCTCCGGGGCGTCTTATAGCCCGGGGTGCCATGCGGCCTACCTGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCGTAATGGTCGTAAGCGA

Name of Depositor CBS
U.S. Patent Number
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.
Chain of Custody
ATCC <-- CBS <-- F Went
Isolation
Ang-quac, fermented rice grain, Java
Cross References

Nucleotide (GenBank) : M83260 Monascus purpureus 18S ribosomal RNA.

References

Shepard D, Carels MS. Red pigment production. US Patent 4,145,254 dated Mar 20 1979

Ohno S, et al. Process for the production of Monascus-pigment. US Patent 4,442,209 dated Apr 10 1984

. . Ann. Sci. Nat. Bot., 8th ser. 1: 1, 1895.

Blanc PJ, et al. Production of citrinin by various species of Monascus. Biotechnol. Lett. 17: 291-294, 1995.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation