Aspergillus fijiensis Varga et al. (ATCC® 1034)

Strain Designations: 4030.3 [CBS 610.78, IMI 119894, NRRL 358, QM 332, WB 358]  /  Product Format: freeze-dried

Deposited As Aspergillus japonicus Saito
Strain Designations 4030.3 [CBS 610.78, IMI 119894, NRRL 358, QM 332, WB 358]
Application
produces L-malic acid
produces citric acid citrate
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments This fungus was re-identified as Aspergillus fijiensis based on the multigene DNA sequence comparison.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCTGGGTCCTTCGGGGCCCAACCTCCCACCCGTGCTTACCGTACCCTGTTGCTTCGGCGGGCCCGCCTTCGGGCGGCCCGGGGCCTGCCCCCGGGACCGCGCCCGCCGGAGACCCCAATGGAACACTGTCTGAAAGCGTGCAGTCTGAGTCGATTGATACCAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTCCCCTCCAGCCCCGCTGGTTGTTGGGCCGCGCCCCCCCGGGGGCGGGCCTCGAGAGAAACGGCGGCACCGTCCGGTCCTCGAGCGTATGGGGCTCTGTCACCCGCTCTATGGGCCCGGCCGGGGCTTGCCTCGACCCCCAATCTTCTCAGATTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTCCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTTGGGTGCGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGGTGTCCGTGCCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCTCGGGGTTCAGCCGGCACTCGTGCCGGTGTACTTCCCCGGGGGCGGGCCAGCGTCAGCTTGGGCGGCCGGTCAAAGGCCTCCGGAATGTAGTGCCCCCCGGGGCACCTTATAGCCGGAGGTGCAATGCGGCCAGCCTGGGCTGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGCAAACGAC


Beta-tubulin

GGTCTACCCCCCTCCGTTGTTGTCCGCCACGGGAGACGCGTCGTTTAGACTTGACTCCCCTGATGCGCCCCCACCAGTTGTTCAATATAAGGATCATGCAGCTAACCTAGTCTTTTCCCACCCAACAGGTTCACCTCCAGACCGGTCAGTGTGTAAGTGAATTCGTGCTGGGACACACAACCTTTGCGGTTCGATATATTCATGCAGTGGACTAAAATATGGGTGCTGGTGACAGGGTAACCAAATTGGTGCCGCTTTCTGGTATGTCTCTACTCGAGTGAATGGATAGATGACATGTTCTGTAGACTCTCACCCAGAGTCAAGAACATTACTGTCAAAGCTTCTCTGTAGTCAATTGAGCTAACAATCTTCCAGGCAGACCATCTCTGGTGAGCACGGCCTCGATGGCGCCGGTGTGTAAGTGCAGACTTCCCGGGCGGCAGGACCAGCGGGTCGCGGAAAATGGTGAAGGATATTAATGGAAAGGACAGTTACAATGGCTCCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTTAACGAGGTTCGTCTTCGAGTCCTCCCTCCGGCTTTCCCGCATCAGCTCCTGACTGCTTCACCAGGCTAGCGGCAACAAGTATGTTCCCCGTGCCGTCCTCGTCGACCTCGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCTTTCGGCCAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAATCCGGTGCTGGTAACAACTGG

Name of Depositor C Thom
Chain of Custody
ATCC <-- C Thom <-- A.F. Blakeslee
Isolation
Soil
References

Bercovitz A, et al. Localization of pyruvate carboxylase in organic acid-producing Aspergillus strains. Appl. Environ. Microbiol. 56: 1594-1597, 1990. PubMed: 2383004