American Type Culture Collection (ATCC) Logo American Type Culture Collection (ATCC) Logo Cart 0
  • Careers
  • Support

Rhodonia placenta (Fries) Niemelä et al.

11538_TT

Live culture (hyphae, spores and/or other fungal structures) grown on ATCC 200 YM medium.
Product category
Fungi
Classification
Fungi, Dikarya, Basidiomycota, Agaricomycotina, Agaricomycetes, Polyporales, Fomitopsidaceae, Rhodonia
Strain designation
Madison 698 [ATCC 44197, Boat-106, CSIRO DFP 7522, FP 94267]
Type strain
No
Isolation source
Douglas fir boat timbers
Geographical isolation
United States; Maryland
Product format
Test tube
Storage conditions
See handling procedure
Mission Collection Item
This is a Mission Collection Item.

Documentation

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.

Detailed product information

General

Specific applications
Degrades coal
Degrades glycosides
Degrades polysaccharides
Fungus resistance testing wood
Produces endoglucanase
Resistant to copper compounds
Resistant to zinc compounds
Testing wood preservatives
Produces extracellular polysaccharide- and glycoside-degrading enzymes
Preceptrol
No

Characteristics

Comments
Does not degrade cellulose in the absence of wood

Handling information

Medium
Temperature
25-30°C
Atmosphere
Aerobic
Handling notes
No special notes.
Additional, updated information on this product may be available on the ATCC® web site at www.atcc.org.

Quality control specifications

Sequenced data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATTTTGAAAGGGGTTGTAGCTGGCCTTTTAGGAGGCATGTGCACACCCTGCTCTTCCATTCTTACACCTGTGCACACTTGTAGGTCGGTTTGAGCGGTTCTCTCTAACGGGGGATGCTGTTTGGCCTTCCTATGTTTTATAACAAACTCTGTAATGTCATAGAATGTCATCGCGTATAACGCATTATAATATAACTTTCAGCAACGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTGGGTATTCCGAGGAGCATGCCGTTTGAGTGTCATGGAATTCTCAACCCTCTTATCCTTGTGGTGAGATTGGGTTGGATTTGGAGGTTTATGCTGGCTTGTAATGAGTCGGCTCCTCTTGAATGCATTAGCTTGGACCTTTGCGGACCACTTTTCGGTGTGATAATTGTCTACGCCGTGGGCTGTGATGCTGTTTAACATGCTTCGGTGTGTTGGGGTTCTGCTTCTAATGGTCCCTT

History

Deposited as
Poria monticola Murrill
Depositors
FF Lombard
Chain of custody
ATCC <-- FF Lombard <-- RW Davidson Boat-106
Type of isolate
Plant

Legal disclaimers

Intended use
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.
Warranty

The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Permits & Restrictions

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

Frequently Asked Questions

References

Curated Citations

Cohen MS, Gabriele PD. Degradation of coal by the fungi Polyporus versicolor and Poria monticola. Appl. Environ. Microbiol. 44: 23-27, 1982.

Wolter KE, et al. A unique polysaccharide- and glycoside-degrading enzyme complex from the wood-decay fungus Poria placenta. Biochem. Biophys. Res. Commun. 97: 1499-1504, 1980. PubMed: 7213375

Clausen CA. Dissociation of the multi-enzyme complex of the brown-rot fungus Postia placenta. FEMS Microbiol Lett 127: 73-78, 1995.

ASTM International Standard Test Method for Wood Preservatives by Laboratory Soil-block Cultures. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 1413-07.

AWPA Standard method of testing wood preservatives by laboratory soil-block cultures. Birmingham, AL: American Wood-Preservers' Association; AWPA E10-06, 2006

View All Curated Citations for this Product

For product-related inquiries and issues, contact Product Experience:

Message Us

Hours of Operation

Monday - Friday
9:00am - 5:00pm
US Eastern Time