Cryptococcus laurentii (Kufferath) Skinner (ATCC® 66036)

Strain Designations: AmMS 230  /  Product Format: freeze-dried

Strain Designations AmMS 230
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGATTGACCGAAAGGTCTTATCTCTATATCCCTCACCTCTGTGAACTGTGGACCTCCGGGTCTGTCTTAACAAACATCAGTGTAATGAACGTATAAATCATTAAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTGAGTGTCATGAAATCTCAATCCCCCCGGGTTTATGATCTGGTCGGGACTTGGACATGGGCGTCTGCCGGTCACACGGCTCGCCTCAAATGACTTAGTGGATCTCTCTGCATCCGTGACAGACGTAATAAGTTTCGTCTTGTCCCTTGCGTACGAGTCCGCTCATAACCTGCCATCGCGCACTTTAGACTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCAGGGCGTCCGAGTTGTAATCTATAGAGGCGTTTTCCGTGCCGGACCGTGTCCAAGTTCCTTGGAACAGGATATCAAAGAGGGTGACAATCCCGTACTTGACACGACGACCGGTGCTCTGTGATACGTCTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAGTTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGACCGAGAGGCTCAGCCGGTTCTGCCGGTGTATTCCCCTCGGTCGGGTCAACATCAGTTTTGTCCGGTGGATAAGGACGGTAGGAAGGTGGCACCCTCGGGTGTGTTATAGCCTGCCGTCGCATACATCGGGTGAGACTGAGGAACGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTCCGAGCTTAGGATGTTGACATAATGGCTTTAAACGAC

Name of Depositor GJ De Leon
References

Espinel-Ingroff A, et al. Comparison of RapID yeast plus system with API 20C system for identification of common, new, and emerging yeast pathogens. J. Clin. Microbiol. 36: 883-886, 1998. PubMed: 9542903

MicroScan Yeast ID QC Set. Dade/Siemens.

RapID™ Yeast PLUS QC Set. Remel™.