Rhodotorula mucilaginosa (Jorgensen) Harrison var. mucilaginosa, anamorph (ATCC® 66034)

Strain Designations: AmMS 232  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Rhodotorula rubra (Demme) Lodder, anamorph
Strain Designations AmMS 232
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain no
Preceptrol® yes
Morphology After 4 days on Emmons’ modification of Sabouraud’s agar at 25°C, colonies are pink, smooth, glossy. Cells are subglobose or ovoidal, single or in pairs, pseudohyphae are absent.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AGGATCATTAGTGAATATAGGACGTCCAACTTAACTTGGAGTCCGAACTCTCACTTTCTAACCCTGTGCACTTGTTTGGGATAGTAACTCTCGCAAGAGAGCGAACTCCTATTCACTTATAAACACAAAGTCTATGAATGTATTAAATTTTATAACAAAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGAGTGTCATGAATACTTCAACCCTCCTCTTTCTTAATGATTGAAGAGGTGTTTGGTTTCTGAGCGCTGCTGGCCTTTACGGTCTAGCTCGTTCGTAATGCATTAGCATCCGCAATCGAACTTCGGATTGACTTGGCGTAATAGACTATTCGCTGAGGAATTCTAGTCTTCGGACTAGAGCCGGGTTGGGTTAAAGGAAGCTTCTAATCAGAATGTCTACATTTTAAGATTAGATCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG

 

 

26S ribosomal RNA gene, partial sequence.

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTATAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAATGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGAGACCCCCGTATATGGTGCGGACGCCCAGCGCTTTGTGATACATTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGAGCAATCGGTTTGCAGGCCAGCATCAGTTTTCCGGGATGGATAATGGTAGAGAGAAGGTAGCAGTTTCGGCTGTGTTATAGCTCTCTGCTGGATACATCTTGGGGGACTGAGGAACGCAGTGTGCCTTTGGCGGGGGTTTCGACCTCTTCACACTTAGGATGCTGGTGGAATGGCTTTAAACGAC

Morphology After 4 days on Emmons’ modification of Sabouraud’s agar at 25°C, colonies are pink, smooth, glossy. Cells are subglobose or ovoidal, single or in pairs, pseudohyphae are absent.
Name of Depositor GJ De Leon
Cross References

Nucleotide (GenBank) : EU853846 ITS including 5.8S rRNA gene

References

MicroScan Yeast ID QC Set. Dade/Siemens.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation