Candida guilliermondii (Castellani) Langeron et Guerra, anamorph (ATCC® 90877)

Alternate State: Yamadazyma guilliermondii (Wickerham) Billon-Grand, teleomorph  /  Strain Designations: B77  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations B77
Alternate State Yamadazyma guilliermondii (Wickerham) Billon-Grand, teleomorph
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
In vitro susceptibility (MIC): 0.06 mg/L itraconazole; 2 mg/L fluconazole; 0.125 mg/L amphotericin B
Morphology After 3 days on YM medium at 25°C, colony is white to cream-colored, smooth, butyrous. Cells globose or ovoidal, single or in pairs, pseudohyphae not observed.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data

18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGATCATTACAGTATTCTTTTGCCAGCGCTTAACTGCGCGGCGAAAAACCTTACACACAGTGTCTTTTTGATACAGAACTCTTGCTTTGGTTTGGCCTAGAGATAGGTTGGGCCAGAGGTTTAACAAAACACAATTTAATTATTTTTACAGTTAGTCAAATTTTGAATTAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCCCCGGGTTTGGTATTGAGTGATACTCTTAGTCGGACTAGGCGTTTGCTTGAAAAGTATTGGCATGGGTAGTACTAGATAGTGCTGTCGACCTCTCAATGTATTAGGTTTATCCAACTCGTTGAATGGTGTGGCGGGATATTTCTGGTATTGTTGGCCCGGCCTTACAACAACCAAACAAGTTTGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAA

 

D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGCCTTCGGTGTCCGAGTTGTAATTTGAAGATTGTAACCTTGGGGTTGGCTCTTGTCTATGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAGGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTCGATATTTTGTGAGCCTTGCCTTCGTGGCGGGGTGACCCGCAGCTTATCGGGCCAGCATCGGTTTGGGCGGTAGGATAATGGCGTAGGAATGTGACTTTACTTCGGTGAAGTGTTATAGCCTGCGTTGATGCTGCCTGCCTAGACCGAGGACTGCGATTTTATCAAGGATGCTGGCATAATGATCCCAAACCGC

Morphology After 3 days on YM medium at 25°C, colony is white to cream-colored, smooth, butyrous. Cells globose or ovoidal, single or in pairs, pseudohyphae not observed.
Name of Depositor H Dermoumi
Special Collection NCRR Contract
Isolation
human blood, Essen, Germany
References

Dermoumi H. In vitro susceptibility of fungal isolates of clinically important specimens to itraconazole, fluconazole and amphotericin B. Chemotherapy 40: 92-98, 1994. PubMed: 8131639

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation