lambda90 (ATCC® 65862)

Organism: Homo sapiens, human  /  Clone Type: Clone  /  Depositors: IB Dawid, P Bray

Permits and Restrictions

View Permits

Designations lambda90
GenBank Number


Species Homo sapiens, human
Depositors IB Dawid, P Bray
The predicted product size is (bp): 247. The observed product size is (bp): 250.
Construct size (kb): 45.0
DNA: genomic
Insert lengths(kb): 14.0
Tissue: placenta
Gene product: zinc finger protein 22( KOX 15) [ZNF22]
Insert Size (kb) 14.0
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Shipping Information Distributed: freeze-dried bacteria-free lysate
Restriction digests of the clone give the following sizes (kb): EcoRI--22.6, 12.5, 6.2, 3.8, 1.95, 1.60; EcoRI/HindIII--22.6, 12.5, 4.0, 3.0, 1.95, 1.60 (doublet), 0.44, 0.26.
Verified to contain the correct insert sequence using the following oligonucleotides (5'-3'): CGGTGTTTCAGCCAGAGCTCCCAC and CCTATACTTAACGGAGGCCAGCCAC.
The predicted product size is (bp): 247. The observed product size is (bp): 250.

Lichter P, et al. Clustering of C2-H2 zinc finger motif sequences within telomeric and fragile site regions of human chromosomes. Genomics 13: 999-1007, 1992. PubMed: 1505991