Candida glabrata (Anderson) Meyer et Yarrow (ATCC® 90030)

Strain Designations: NCCLS 84  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Torulopsis glabrata (Anderson) Lodder et de Vries
Strain Designations NCCLS 84
Application
Susceptibility testing antifungal agents
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence:

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAAATTTAATTGATTTGTCTGAGCTCGGAGAGAGACATCTCTGGGGAGGACCAGTGTAGACACTCAGGAGGCTCCTAAAATATTTTCTCTGCTGTGAATGCCATTTCTCCTGCCTGCGCTTAAGTGCGCGGTTGGTGGGTGTTCTGCAGTGGGGGGAGGGAGCCGACAAAGACCTGGGAGTGTGCGTGGATCTCTCTATTCCAAAGGAGGTGTTTTATCACACGACTCGACACTTTCTAATTACTACACACAGTGGAGTTTACTTTACTACTATTCTTTTGTTCGTTGGGGGAACGCTCTCTTTCGGGGGGGAGTTCTCCCAGTGGATGCAAACACAAACAAATATTTTTTTAAACTAATTCAGTCAACACAAGATTTCTTTTAGTAGAAAACAACTTCAAAACTTTCAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACACGTTGTGTTTGGTAGTGAGTGATACTCTCGTTTTTGAGTTAACTTGAAATTGTAGGCCATATCAGTATGTGGGACACGAGCGCAAGCTTCTCTATTAATCTGCTGCTCGTTTGCGCGAGCGGCGGGGGTTAATACTGTATTAGGTTTTACCAACTCGGTGTTGATCTAGGGAGGGATATGTGAGTGTTTTGTGCGTGCTGGGCAGACAGACGTCTTTAAGTTTGACCTCAAATCAGGTAGGGTTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTGGTGCCCGAGTTGTAATTTGGAGAGTACCACTTTGGGACTGTACTTTGCCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTGTGGCGAGGGTGTCAGTTCTTTGTAAAGGGTGCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCTTGCCTCTCGTGGGCTTGGGACTCTCGCAGCTCACTGGGCCAGCATCGGTTTTGGCGGCCGGAAAAAACCTAGGGAATGTGGCTCTGCGCCTCGGTGTAGAGTGTTATAGCCCTGGGGAATACGGCCAGCCGGGACCGAGGACTGCGATACTTGTTATCTAGGATGCTGGCATAATGGTTATATGCCGC

Name of Depositor MA Pfaller
Chain of Custody ATCC <-- MA Pfaller
Isolation
Blood, Iowa
Cross References

Nucleotide (GenBank) : KU729066 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729149 D1/D2 region of 26S rRNA gene

Nucleotide (GenBank) : AJ289782 Candida glabrata partial ORF1 for putative mitochondrial protein.

References

Espinel-Ingroff A, et al. Collaborative comparison of broth macrodilution and microdilution antifungal susceptibility tests. J Clin Microbiol 30: 3138-3145, 1992. PubMed: 1452697

Medical microbiology--Susceptibility testing of microbial pathogens to antimicrobial agents -- Part 84: Microdilution; Special requirements for testing of fungi against antifungal agents. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 58940-84: 2002, 2002

Niimi K, et al. Reconstitution of high-level micafungin resistance detected in a clinical isolate of Candida glabrata identifies functional homozygosity in glucan synthase gene expression. J Antimicrob Chemother 67: 1666-1676, 2012. PubMed: 22514266

Innings A, et al. Multiplex real-time PCR targeting the RNase P RNA gene for detection and identification of Candida species in blood. J Clin Microbiol 45: 874-880, 2007. PubMed: 17215340

Leinberger DM, et al. Development of a DNA microarray for detection and identification of fungal pathogens involved in invasive mycoses. J Clin Microbiol 43: 4943-4953, 2005. PubMed: 16207946

Yamada Y, et al. Phylogenetic relationships among medically important yeasts based on sequences of mitochondrial large subunit ribosomal RNA gene. Mycoses 47: 24-28, 2004. PubMed: 14998395

Becker K, et al. Isolation and characterization of a species-specific DNA fragment for identification of Candida (Torulopsis) glabrata by PCR. J. Clin. Microbiol. 39: 3356-3359, 2001. PubMed: 11526177

Sanson GF, Briones MR. Typing of Candida glabrata in clinical isolates by comparative sequence analysis of the cytochrome c oxidase subunit 2 gene distinguishes two clusters of strains associated with geographical sequence polymorphisms. J Clin Microbiol 38: 227-235, 2000. PubMed: 10618092

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation