Candida magnoliae (Lodder et Kreger-van Rij) Meyer et Yarrow (ATCC® 42811)

Strain Designations: 71P  /  Product Format: freeze-dried

Deposited As Torulopsis magnoliae Lodder et Kreger-van Rij
Strain Designations 71P
Application
produces bee bread
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTTTTGAACCAAATATAACACTGTGACGAGCCCTTGCGTAGCGAGGGCGACTGCTTCCGGTTCGCCGGGCTTTACTTTTAACCAAATCTGATTTATTGAAGAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCAAAGCGCGATAGGTAATGCGAATTGCAGACGTGAGTCATTGAATCTTTGAACGCACATTGCGCCAGTTTACTGGCATACTGCGTTGAGCGTCGGCCTTCCTCCACAGGTGCTGCTACTTACAGTAGTGAAAGGCATGGAAACGCACCCGTTAGCAAACCGGTGCTGACCTACAAATTCTTCGACCTCAGCGTAGTAAGATTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAATGGCGAATGAACAGGCAAAAGCTCAGATTTGAAACCCTCGGGATTGTAATCTGGAGACCTGGATTTGGCACGCTGACCAAGTCTTCTGGAACGGAGCGCCATGGAGGGTGACAGCCCCGTAGCAGCAGCCGCAGTAAATCCGGGTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATGCTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAATGGAAGGCAATGAGGTGCGATTGACCCGGACGTTTGCGGGCAGCACAAAAGCGCAGGCCGCCTCGGCATTGCCTGCGTGCATACTGCCTCGCGGACCACCGGTTCTAACAACGCCTTATTGCAC

Name of Depositor M Gilliam
Isolation
Almond pollen pellets
References

Gilliam M. Microbiology of pollen and bee bread: the yeasts. Apidologie 10: 43-53, 1979.