Aspergillus fumigatus Fresenius (ATCC® 90241)

Strain Designations: W3568/2AF/88/2/1  /  Product Format: freeze-dried

Deposited As Aspergillus fumigatus Fresenius, anamorph
Strain Designations W3568/2AF/88/2/1
Application
Biomedical Research and Development Material
Emerging infectious disease research
Opportunistic pathogen research
Respiratory research
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Epidemiology, isolate 2
Preservation
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

Name of Depositor DW Denning
Chain of Custody
ATCC <-- DW Denning <-- Stanford Univ. Hosp.
Isolation
Bronchioalveolar lavage of heart-lung transplant recipient, Stanford, CA
Cross References

Nucleotide (GenBank) : KC689326 ITS including 5.8S rRNA gene

References

Denning DW, et al. Quantitative preservation of viability of Aspergillus fumigatus. J. Med. Vet. Mycol. 30: 485-488, 1992. PubMed: 1287169

Denning DW, et al. Restriction endonuclease analysis of total cellular DNA of Aspergillus fumigatus isolates of geographically and epidemiologically diverse origin. J. Infect. Dis. 162: 1151-1158, 1990. PubMed: 1977804